OR7D2 (AK096194) Human Untagged Clone
CNY 9120.00
货期*
4周
规格
Product images

推荐一起购买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK096194, the custom clone sequence may differ by one or more nucleotides
ATGTGCTCTGGGAGATTCCAGAATATTCAAGTAAATCCGGATTTTCCCAGAGGCAGAATA TCTAACTCCTTCAGGAGAACTTCCAGTACAGAAAACAAAACAAAGACGCTGGGGAAACTT CACCAAGAGCCTCGGCAGCTCCAGAGCGACGGGAAACGAAAGGTCAGGGGGTCGATCGGC AAACCCTTTCTGGTTTGGGGTGCGTGTAACTATAGGGACTTTTGTCTCAGTGAAGAGGCA GGAGAAACTGCCTGCCGGGCGAGTCCAGGACAATGCTATGTTACTTCGTGTTGCTTGAGC CGTCATTGCACTTGTTCCCTCACCTGGTGGGATGTGCTTTTGAATTGGGTTGGTTGGCTT TTGAGAATCCTTTCCCTCTCTGCCCAGGCACCTTCTGTTCTCTTTCCCTTCCTG |
Restriction Sites | Please inquire |
ACCN | AK096194 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | AK096194.1 |
RefSeq Size | 3010 bp |
RefSeq ORF | 3010 bp |
Locus ID | 162998 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Olfactory transduction |
Gene Summary | Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...