KLC1 (AK092888) Human Untagged Clone

CAT#: SC312497

(untagged)-Human cDNA FLJ35569 fis, clone SPLEN2005783



CNY 9120.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-KLC1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for AK092888, the custom clone sequence may differ by one or more nucleotides
ATGTGGGAGCCCCTTGGGCTGTCTCATCATTTAGCAGTTGTCTTTACAGTGGTCCCATCC
TCTGTAAAGACACACAGAGCCACATCACACATCCTCTATCCTAGGTGGAGCCCGGGGTCT
GCCTCCCAGCTGCACCACCTTTGTCTGTCTGCAGGTCGCCAGCTCTGCTGGGGCCTTCTG
AAGCAGCCTCTCTCCGTCTTGCCATTCTTTTCACACTGCTCCCATGTTAAGATTTCTACA
CGTTTCGAAGACACTAAATTCTTACCTAGGATTATTGGGGAATGGAATATATGGTTAGAA
ATAGATGAATTTTTATTTTTAAAAAATGACAATAAGGGCTGGACGAGGTGGCTCATGCCT
GTAATCCCAGGACTTTGGGAGGCCGAGGCGGGTGGATCACTTGAGGCCAGGAGTTCGAGA
CCAGCCTGGCCAACATGGCGAAAACTCGTCTGTGCGAAAAAAACAAAAATCAGCCAGGCA
TGGTCGTGCGCGCCTGTAATCCCAGTTACTCAGGAGGCTGAGGCGGGGAATTGCTTGAAC
CCAGTAGGTGGAGGCTGCATTGAGCCAAGATCATGCCACTGCACTCCAGCCTGGGTGACA
GAGCCAGAATCTGTCTCAAATTACACTAGTAAGACAACTAGAATATGCCAAAAA
Restriction Sites Please inquire     
ACCN AK092888
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq AK092888.1
RefSeq Size 2841 bp
RefSeq ORF 2841 bp
Locus ID 3831
Protein Families Druggable Genome
Gene Summary Conventional kinesin is a tetrameric molecule composed of two heavy chains and two light chains, and transports various cargos along microtubules toward their plus ends. The heavy chains provide the motor activity, while the light chains bind to various cargos. This gene encodes a member of the kinesin light chain family. It associates with kinesin heavy chain through an N-terminal domain, and six tetratricopeptide repeat (TPR) motifs are thought to be involved in binding of cargos such as vesicles, mitochondria, and the Golgi complex. Thus, kinesin light chains function as adapter molecules and not motors per se. Although previously named "kinesin 2", this gene is not a member of the kinesin-2 / kinesin heavy chain subfamily of kinesin motor proteins. Extensive alternative splicing produces isoforms with different C-termini that are proposed to bind to different cargos; however, the full-length nature and/or biological validity of most of these variants have not been determined. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...