Adenylate kinase 5 (AK5) (AK090967) Human Untagged Clone
CAT#: SC312597
(untagged)-Human cDNA FLJ33648 fis, clone BRAMY2024449, weakly similar to ADENYLATE KINASE ISOENZYME 1 (EC 2.7.4.3)
CNY 9120.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AK6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK090967, the custom clone sequence may differ by one or more nucleotides
ATGAACACCAACGATGCCAAGGAGTATCTGGCCCGGAGGGAAATCCCTCAGCTTTTTGAG AGCCTTTTGAATGGACTGATGTGTTCTAAGCCCGAAGATCCAGTAGAATACTTGGAAAGT TGTTTACAAAAAGTAAAGGAACTGGGTGGCTGTGACAAGGTGAAATGGGATACATTTGTA AGCCAGGAAAAGAAGACCTTACCCCCACTAAATGGAGGACAGTCACGGAGATCCTTTCTA AGAAATGAAAGTGACACGGATCTCTCTGAGACTGCAGAGTTGATTGAGGAGTATGAGGTT TTTGATCCTACCAGACCTCGACCAAAAATCATTCTTGTTATAGGTGGTCCAGGAAGTGGA AAGGGTACTCAGAGTTTGAAAATTGCAGAACGATATGGATTCCAATACATTTCTGTGGGA GAATTATTAAGAAAGAAGATCCACAGTACCAGCAGCAATAGGAAATGGAGTCTTATTGCC AAGATAATTACAACTGGAGAATTGGCCCCACAGGAAACAACAATTACAGAGATAAAACAA AAATTGATGCAAATACCTGATGAAGAGGGCATTGTTATTGATGGATTTCCAAGAGATGTT GCCCAGGCTCTATCTTTTGAGGACCAATACAGCCTACGCCCTCAGACAAAGATGCCTGTG CAGTCAGATCCTCTCCCTTACGCTGCTCCCTGCGGGGTATGTCCAGTCCGTCAAGATTCT CCC |
Restriction Sites | Please inquire |
ACCN | AK090967 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | AK090967.1, BAC03558.1 |
RefSeq Size | 2148 bp |
RefSeq ORF | 2148 bp |
Locus ID | 26289 |
Domains | ADK |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Purine metabolism |
Gene Summary | This gene encodes a member of the adenylate kinase family, which is involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. This member is related to the UMP/CMP kinase of several species. It is located in the cytosol and expressed exclusively in brain. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Adenylate kinase 5产品