DOCK5 (BC011877) Human Untagged Clone

CAT#: SC313068

DOCK5 (untagged)-Homo sapiens, Similar to dedicator of cyto-kinesis 1, clone IMAGE:3347029



CNY 13400.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms dedicator of cytokinesis 5; DKFZp451J181; DKFZp779M164; DKFZp781J211
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC011877, the custom clone sequence may differ by one or more nucleotides
ATGGCCCGCTGGATCCCGACCAAGAGGCAGAAGTACGGGGTTGCGATCTATAACTACAAT
GCTTCTCAAGATGTGGAGCTCTCCTTGCAGATCGGTGACACAGTTCACATCCTGGAGATG
TACGAGGGTTGGTACAGAGGATATACCCTCCAAAATAAATCTAAAAAGGGCATTTTCCCT
GAAACATATATCCATTTGAAAGAGGCAACTGTGGAAGACCTGGGGCAGCATGAAACCGTG
ATTCCTGGCGAGCTCCCCCTGGTGCAGGAGCTCACGTCCACTCTGCGAGAATGGGCTGTC
ATCTGGCGAAAGCTCTACGTGAACAACAAGCTCACCCTCTTCCGCCAGCTGCAGCAGATG
ACGTACAGCCTGATCGAGTGGCGGTCCCAGATCCTGTCTGGGACGCTCCCCAAGGATGAA
CTGGCAGAGCTCAAGAAGAAAGTCACAGCCAAAATTGATCATGGGAACAGAATGCTGGGG
TTAGATCTGGTGGTGCGAGATGACAATGGGAACATCCTAGACCCTGACGAAACCAGCACC
ATTGCCCTCTTCAAGGCCCATGAGGTGGCCTCCAAAAGGATTGAGGAAAAGATCCAAGAA
GAGAAGTCAATCCTGCAGAACCTCGATTTGCGGGGCCAGTCCATCTTCAGTACCATCCAC
ACCTATGGCCTCTATGTGAACTTCAAGAACTTTGTCTGCAACATCGGGGAAGATGCAGAG
TTGTTTATGGCCCTCTACGACCCAGACCAGTCCACTTTTATCAGTGAGAACTATCTAATT
CGTTGGGGCAGTAACGGGATGCCCAAGGAAATAGAGAAGCTCAATAACCTCCAAGCAGTG
TTTACAGACCTTAGCAGCATGGACCTCATCCGGCCCCGCGTCAGCCTTGTATGCCAGATT
GTCCGCGTGGGCCATATGGAGCTGAAGGAAGGCAAGAAGCACACCTGTGGACTCCGAAGA
CCTTTTGGAGTGGCAGTGATGGATATTACTGATATCATACATGGGAAGGTGGATGATGAA
GAAAAGCAGCATTTTATTCCCTTTCAGCAG
Restriction Sites Please inquire     
ACCN BC011877
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC011877.1
RefSeq Size 2177 bp
RefSeq ORF 2177 bp
Locus ID 80005
Domains SH3
Gene Summary This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family act as guanine nucleotide exchange factors for small Rho family G proteins. The protein encoded by this gene is thought to associate with adaptors CRK and CRKL, and function in regulation of intestinal epithelial cell spreading and migration on collagen IV. Similar proteins in mouse and zebrafish also function in myoblast fusion. [provided by RefSeq, Oct 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...