PI 3 Kinase p85 alpha (PIK3R1) (NM_181524) Human Untagged Clone

CAT#: SC313404

PIK3R1 (untagged)-Human phosphoinositide-3-kinase, regulatory subunit 1 (alpha) (PIK3R1), transcript variant 3



  "NM_181524" in other vectors (4)

CNY 6840.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Antibody against PIK3R1 (N-term L11)
    • 400 ul

CNY 6314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AGM7; GRB1; IMD36; p85; p85-ALPHA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC313404 representing NM_181524.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCATAACCTGCAAACACTGCCTCCTAAACCACCAAAACCTACTACTGTAGCCAACAACGGTATGAAT
AACAATATGTCCTTACAAGATGCTGAATGGTACTGGGGAGATATCTCGAGGGAAGAAGTGAATGAAAAA
CTTCGAGATACAGCAGACGGGACCTTTTTGGTACGAGATGCGTCTACTAAAATGCATGGTGATTATACT
CTTACACTAAGGAAAGGGGGAAATAACAAATTAATCAAAATATTTCATCGAGATGGGAAATATGGCTTC
TCTGACCCATTAACCTTCAGTTCTGTGGTTGAATTAATAAACCACTACCGGAATGAATCTCTAGCTCAG
TATAATCCCAAATTGGATGTGAAATTACTTTATCCAGTATCCAAATACCAACAGGATCAAGTTGTCAAA
GAAGATAATATTGAAGCTGTAGGGAAAAAATTACATGAATATAACACTCAGTTTCAAGAAAAAAGTCGA
GAATATGATAGATTATATGAAGAATATACCCGCACATCCCAGGAAATCCAAATGAAAAGGACAGCTATT
GAAGCATTTAATGAAACCATAAAAATATTTGAAGAACAGTGCCAGACCCAAGAGCGGTACAGCAAAGAA
TACATAGAAAAGTTTAAACGTGAAGGCAATGAGAAAGAAATACAAAGGATTATGCATAATTATGATAAG
TTGAAGTCTCGAATCAGTGAAATTATTGACAGTAGAAGAAGATTGGAAGAAGACTTGAAGAAGCAGGCA
GCTGAGTATCGAGAAATTGACAAACGTATGAACAGCATTAAACCAGACCTTATCCAGCTGAGAAAGACG
AGAGACCAATACTTGATGTGGTTGACTCAAAAAGGTGTTCGGCAAAAGAAGTTGAACGAGTGGTTGGGC
AATGAAAACACTGAAGACCAATATTCACTGGTGGAAGATGATGAAGATTTGCCCCATCATGATGAGAAG
ACATGGAATGTTGGAAGCAGCAACCGAAACAAAGCTGAAAACCTGTTGCGAGGGAAGCGAGATGGCACT
TTTCTTGTCCGGGAGAGCAGTAAACAGGGCTGCTATGCCTGCTCTGTAGTGGTGGACGGCGAAGTAAAG
CATTGTGTCATAAACAAAACAGCAACTGGCTATGGCTTTGCCGAGCCCTATAACTTGTACAGCTCTCTG
AAAGAACTGGTGCTACATTACCAACACACCTCCCTTGTGCAGCACAACGACTCCCTCAATGTCACACTA
GCCTACCCAGTATATGCACAGCAGAGGCGATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_181524
Insert Size 1275 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181524.1
RefSeq Size 5823 bp
RefSeq ORF 1275 bp
Locus ID 5295
UniProt ID P27986
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, Apoptosis, B cell receptor signaling pathway, Chemokine signaling pathway, Chronic myeloid leukemia, Colorectal cancer, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Glioma, Insulin signaling pathway, Jak-STAT signaling pathway, Leukocyte transendothelial migration, Melanoma, mTOR signaling pathway, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pancreatic cancer, Pathways in cancer, Phosphatidylinositol signaling system, Progesterone-mediated oocyte maturation, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, Small cell lung cancer, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, VEGF signaling pathway
MW 50 kDa
Gene Summary Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (3) uses an alternate in-frame exon in the 5' coding region, compared to variant 1. The encoded isoform (3) has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...