DPH3 (NM_001047434) Human Untagged Clone
CAT#: SC315392
DPH3 (untagged)-Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DELGIP; DELGIP1; DESR1; DPH3A; KTI11; ZCSL2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001047434, the custom clone sequence may differ by one or more nucleotides
ATGGCAGTGTTTCATGACGAGGTGGAAATCGAGGACTTCCAATATGACGAGGACTCGGAG ACGTATTTCTATCCCTGCCCATGTGGAGATAACTTCTCCATCACCAAGGATCAGTTTGTG TGTGGAGAAACAGTCCCAGCCCCTTCAGCCAACAAAGAATTAGTTAAATGC |
Restriction Sites | Please inquire |
ACCN | NM_001047434 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001047434.1, NP_001040899.1 |
RefSeq Size | 583 bp |
RefSeq ORF | 174 bp |
Locus ID | 285381 |
UniProt ID | Q96FX2 |
Gene Summary | This gene encodes a CSL zinc finger-containing protein that is required for dipthamide biosynthesis. The encoded protein is necessary for the initial step in the modification of a histidine residue in elongation factor-2 to diphthamide. This modified residue is a target for ADP ribosylation by the bacterial toxins diphtheria toxin and Pseudomonas exotoxin A. Alternative splicing results in multiple transcript variants that encode the same isoform. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (2) lacks an exon in the coding region but maintains the reading frame compared to variant 1. This variant encodes isoform 2, which is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223888 | DPH3 (Myc-DDK-tagged)-Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 2 |
CNY 3990.00 |
|
RC223888L3 | Lenti-ORF clone of DPH3 (Myc-DDK-tagged)-Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 2 |
CNY 5890.00 |
|
RC223888L4 | Lenti-ORF clone of DPH3 (mGFP-tagged)-Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 2 |
CNY 5890.00 |
|
RG223888 | DPH3 (tGFP-tagged) - Human DPH3, KTI11 homolog (S. cerevisiae) (DPH3), transcript variant 2 |
CNY 4370.00 |