YY1 associated factor 2 (YAF2) (NM_005748) Human Untagged Clone
CAT#: SC315481
YAF2 (untagged)-Human YY1 associated factor 2 (YAF2), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315481 representing NM_005748.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGAGACAAGAAGAGCCCCACCAGGCCGAAGCGGCAGCCGAAGCCGTCCTCGGATGAGGGTTACTGG GACTGTAGCGTCTGCACCTTCCGGAACAGCGCCGAGGCCTTCAAGTGCATGATGTGCGATGTGCGGAAG GGCACCTCCACCCGGAAACCTCGACCTGTCTCCCAGTTGGTTGCACAGCAGGTTACTCAGCAGTTTGTG CCTCCTACACAGTCAAAGAAAGAGAAAAAAGATAAAGTAGAAAAAGAAAAAAGTGAAAAGGAAACAACT AGCAAAAAGAATAGCCATAAGAAAACCAGGCCAAGATTGAAAAATGTGGATCGGAGTAGTGCTCAGCAT TTGGAAGTTACTGTTGGAGATCTGACAGTCATTATTACAGACTTTAAGGAGAAAACAAAGTCACCGCCT GCATCTAGTGCTGCTTCTGCAGATCAACACAGTCAAAGCGGCTCTAGCTCTGATAACACAGAGAGAGGA ATGTCCAGGTCATCTTCACCCAGAGGAGAAGCCTCATCATTGAATGGAGAATCTCATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_005748 |
Insert Size | 543 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005748.5 |
RefSeq Size | 4225 bp |
RefSeq ORF | 543 bp |
Locus ID | 10138 |
UniProt ID | Q8IY57 |
Domains | zf-RanBP |
Protein Families | Druggable Genome, Transcription Factors |
MW | 19.9 kDa |
Gene Summary | This gene encodes a zinc finger containing protein that functions in the regulation of transcription. This protein was identified as an interacting partner of transcriptional repressor protein Yy1, and also interacts with other transcriptional regulators, including Myc and Polycomb. This protein can promote proteolysis of Yy1. Multiple alternatively spliced transcript variants have been found. [provided by RefSeq, Feb 2016] Transcript Variant: This variant (2) lacks an in-frame exon compared to variant 1. The resulting isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214071 | YAF2 (Myc-DDK-tagged)-Human YY1 associated factor 2 (YAF2), transcript variant 2 |
CNY 2,400.00 |
|
RC214071L1 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214071L2 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC214071L3 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214071L4 | Lenti ORF clone of Human YY1 associated factor 2 (YAF2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG214071 | YAF2 (tGFP-tagged) - Human YY1 associated factor 2 (YAF2), transcript variant 2 |
CNY 4,370.00 |
其它YY1 associated factor 2产品