United States
Germany
Japan
United Kingdom
China
Diazepam Binding Inhibitor (DBI) (NM_001079863) Human Untagged Clone
CAT＃: SC315662
DBI (untagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACBD1; ACBP; CCK-RP; EP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001079863 edited
ATGCCTGCGTTTGCTGAGTTTGAGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAG CCATCGGATGAGGAGATGCTGTTCATCTATGGCCACTACAAACAAGCAACTGTGGGCGAC ATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGG AATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAA GAGCTAAAGAAAAAATACGGGATATGAGAGACTGGATTTGGTTACTGTGCCATGTGTTTA TCCTAAACTGAGACAATGCCTTGTTTTTTTCTAATACCGTGGATGGTGGGAATTCGGGAA AATAACCAGTTAAACCAGCTACTCAAGGCTGCTCACCATACGGCTCTAACAGATTAGGGG CTAAAACGATTACTGACTTTCCTTGAGTAGTTTTTATCTGAAATCAATTAAAAGTGTATT TGTTACTTTAAATAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001079863 |
| Insert Size | 500 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001079863.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001079863.1, NP_001073332.1 |
| RefSeq Size | 740 bp |
| RefSeq ORF | 267 bp |
| Locus ID | 1622 |
| UniProt ID | P07108 |
| Protein Families | Druggable Genome |
| Protein Pathways | PPAR signaling pathway |
| Gene Summary | This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2, also known as 1c) differs in the 5' UTR and 5' coding region, as compared to variant 5. The resulting isoform (2) has a shorter and distinct N-terminus, compared to isoform 5. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219502 | DBI (Myc-DDK-tagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 2 |
CNY 1,920.00 |
|
| RC219502L3 | Lenti-ORF clone of DBI (Myc-DDK-tagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 2 |
CNY 5,890.00 |
|
| RC219502L4 | Lenti-ORF clone of DBI (mGFP-tagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 2 |
CNY 5,890.00 |
|
| RG219502 | DBI (tGFP-tagged) - Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 2 |
CNY 4,370.00 |
