VAV3 (NM_001079874) Human Untagged Clone

CAT#: SC315719

VAV3 (untagged)-Human vav 3 guanine nucleotide exchange factor (VAV3), transcript variant 2



  "NM_001079874" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


VAV3 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315719 representing NM_001079874.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCAATTTTTACATTTCTTTCAGAACAAGGGACACTCAAACTACCAGAGAAACGGACCAATGGACTG
CGAAGAACTCCTAAACAGGTGGATCCAGGTTTACCAAAGATGCAGGTCATTAGGAACTATTCTGGAACA
CCACCCCCAGCTCTGCATGAAGGACCCCCTTTACAGCTCCAGGCCGGGGATACCGTTGAACTTCTGAAA
GGAGATGCACACAGTCTGTTTTGGCAGGGCAGAAATTTAGCATCTGGAGAGGTTGGATTTTTTCCAAGT
GATGCAGTCAAGCCTTGCCCATGTGTGCCCAAACCAGTAGATTATTCTTGCCAACCCTGGTATGCTGGA
GCAATGGAAAGATTGCAAGCAGAGACCGAACTTATTAATAGGGTAAATAGTACTTACCTTGTGAGGCAC
AGGACCAAAGAGTCAGGAGAATATGCAATTAGCATTAAGTACAATAATGAAGCAAAGCACATCAAGATT
TTAACAAGAGATGGCTTTTTTCACATTGCAGAAAATAGAAAATTTAAAAGTTTAATGGAACTTGTGGAG
TACTACAAGCATCATTCTCTCAAGGAAGGGTTCAGAACCTTAGATACAACTCTGCAGTTTCCATACAAG
GAGCCAGAACATTCAGCTGGACAGAGGGGTAATAGAGCAGGCAACAGCTTGTTAAGTCCAAAAGTGCTG
GGCATTGCCATCGCTCGGTATGACTTCTGTGCAAGAGATATGAGAGAGTTGTCCTTGTTGAAAGGAGAT
GTGGTGAAGATTTACACAAAGATGAGTGCAAATGGCTGGTGGAGAGGAGAAGTAAATGGCAGGGTGGGC
TGGTTTCCATCCACATATGTGGAAGAGGATGAATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001079874
Insert Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001079874.1
RefSeq Size 3115 bp
RefSeq ORF 864 bp
Locus ID 10451
UniProt ID Q9UKW4
Protein Families Druggable Genome
Protein Pathways B cell receptor signaling pathway, Chemokine signaling pathway, Fc epsilon RI signaling pathway, Fc gamma R-mediated phagocytosis, Focal adhesion, Leukocyte transendothelial migration, Natural killer cell mediated cytotoxicity, Regulation of actin cytoskeleton, T cell receptor signaling pathway
MW 32.6 kDa
Gene Summary This gene is a member of the VAV gene family. The VAV proteins are guanine nucleotide exchange factors (GEFs) for Rho family GTPases that activate pathways leading to actin cytoskeletal rearrangements and transcriptional alterations. This gene product acts as a GEF preferentially for RhoG, RhoA, and to a lesser extent, RAC1, and it associates maximally with the nucleotide-free states of these GTPases. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2, also known as vav3.1) contains a novel 5' exon, and is missing most of the exons found in the 5' half of variant 1. This is a shorter isoform, and consists mostly of the C-terminal SH3-SH2-SH3 region.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...