ALP (PDLIM3) (NM_001114107) Human Untagged Clone

CAT#: SC318828

PDLIM3 (untagged)-Human PDZ and LIM domain 3 (PDLIM3), transcript variant 2



  "NM_001114107" in other vectors (4)

CNY 6,270.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-PDLIM3 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001114107, the custom clone sequence may differ by one or more nucleotides
ATGCCCCAGACGGTGATCCTCCCGGGCCCTGCGCCCTGGGGCTTCAGGCTCTCAGGGGGC
ATAGACTTCAACCAGCCTTTGGTCATCACCAGGATTACACCAGGAAGCAAGGCGGCAGCT
GCCAACCTGTGTCCTGGAGATGTCATCCTGGCTATTGACGGCTTTGGGACAGAGTCCATG
ACTCATGCTGATGCGCAGGACAGGATTAAAGCAGCAGCTCACCAGCTGTGTCTCAAAATT
GACAGGGGAGAAACTCACTTATGGTCTCCACAAGTATCTGAAGATGGGAAAGCCCATCCT
TTCAAAATCAACTTAGAATCAGAACCACAGGAATTCAAACCCATTGGTACCGCGCACAAC
AGAAGGGCCCAGCCTTTTGTTGCAGCTGCAAACATTGATGACAAAAGACAGGTAGTGAGC
GCTTCCTATAACTCGCCAATTGGGCTCTATTCAACTAGCAATATACAAGATGCGCTTCAC
GGACAGCTGCGGGGTCTCATTCCTAGCTCACCTCAAAACGAGCCCACAGCCTCGGTGCCC
CCCGAGTCGGACGTGTACCGGATGCTCCACGACAATCGGAATGAGCCCACACAGCCTCGC
CAGTCGGGCTCCTTCAGAGTGCTCCAGGGAATGGTGGACGATGGCTCTGATGACCGTCCG
GCTGGAACGCGGAGTGTGAGAGCTCCGGTGACGAAAGTCCATGGCGGTTCAGGCGGGGCA
CAGAGGATGCCGCTCTGTGACAAATGTGGGAGTGGCATAGTCGGTGCTGTGGTGAAGGCG
CGGGATAAGTACCGGCACCCTGAGTGCTTCGTGTGTGCCGACTGCAACCTCAACCTCAAG
CAAAAGGGCTACTTCTTCATAGAAGGGGAGCTGTACTGCGAAACCCACGCAAGAGCCCGC
ACAAAGCCCCCAGAGGGCTATGACACGGTCACTCTGTATCCCAAAGCT
Restriction Sites Please inquire     
ACCN NM_001114107
Insert Size 2709 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001114107.1, NP_001107579.1
RefSeq Size 2709 bp
RefSeq ORF 2709 bp
Locus ID 27295
UniProt ID Q53GG5
Gene Summary The protein encoded by this gene contains a PDZ domain and a LIM domain, indicating that it may be involved in cytoskeletal assembly. In support of this, the encoded protein has been shown to bind the spectrin-like repeats of alpha-actinin-2 and to colocalize with alpha-actinin-2 at the Z lines of skeletal muscle. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Aberrant alternative splicing of this gene may play a role in myotonic dystrophy. [provided by RefSeq, Apr 2012]
Transcript Variant: This variant (2) lacks two consecutive exons in the coding region and contains an alternate coding exon, but maintains the reading frame, compared to variant 1. The encoded isoform (b) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...