LIMS1 (NM_004987) Human Untagged Clone
CAT#: SC319714
LIMS1 (untagged)-Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PINCH; PINCH-1; PINCH1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_004987.3
ACTCTTGAATTAAGAGAAGGGGAGCTGGAGGTGGCTCAGGTAGAGTGCGTAGGTTTGCAG
AACTGGGCCTGTGTGTGTAAAGTGACTAAGGCAAAGGAGTGGAAGTTTGAGAGAAGTTTA AGAGAAGAAATGGACATGATTGCCTAAATCAGCCAAACACAGGCAACATGGCCAACGCCC TGGCCAGCGCCACTTGCGAGCGCTGCAAGGGCGGCTTTGCGCCCGCTGAGAAGATCGTGA ACAGTAATGGGGAGCTGTACCATGAGCAGTGTTTCGTGTGCGCTCAGTGCTTCCAGCAGT TCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGAAAGTACTGTGAACATGACTTTCAGA TGCTCTTTGCCCCTTGCTGTCATCAGTGTGGTGAATTCACCATTGGCCGAGTTATCAAAG CCATGAATAACAGCTGGCATCCGGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTTCTGG CAGATATCGGGTTTGTCAAGAATGCTGGGAGACACCTGTGTCGCCCCTGTCATAATCGTG AGAAAGCCAGAGGCCTTGGGAAATACATCTGCCAGAAATGCCATGCTATCATCGATGAGC AGCCTCTGATATTCAAGAACGACCCCTACCATCCAGACCATTTCAACTGCGCCAACTGCG GGAAGGAGCTGACTGCCGATGCACGGGAGCTGAAAGGGGAGCTATACTGCCTCCCATGCC ATGATAAAATGGGGGTCCCCATCTGTGGTGCTTGCCGACGGCCCATCGAAGGGCGCGTGG TGAACGCTATGGGCAAGCAGTGGCATGTGGAGCATTTTGTTTGTGCCAAGTGTGAGAAAC CCTTTCTTGGACATCGCCATTATGAGAGGAAAGGCCTGGCATATTGTGAAACTCACTATA ACCAGCTATTTGGTGATGTTTGCTTCCACTGCAATCGTGTTATAGAAGGTGGTGTGGTCT CTGCTCTTAATAAGGCCTGGTGCGTGAACTGCTTTGCCTGTTCTACCTGCAACACTAAAT TAACACTCAAGAATAAGTTTGTGGAGTTTGACATGAAGCCAGTCTGTAAGAAGTGCTATG AGAAATTTCCATTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGA AATAAGTTCCTTTATTTTTTCTTTTCTATGCAAGATAAGAGATTACCAACATTACTTGTC TTGATCTACCCATATTTAAAGCTATATCTCAAAGCAGTTGAGAGAAGAGGACCTATATGA ATGGTTTTATGTCATTTTTTTAATTAAAAAAGAAAAATTCATATAATCGTGTTTAAAACA CAAATGAAGTCAGTATTTGCCTTTGTTAACCCTTATCCATTTGTTGACATGTAGACTGTT TACAAAAAAAAAACACATGGTTAAATGTTAAATTTTAATTAAGGCCCCCAAAAATTAAAT ATAACTTTTTAAAATGAAAGGAGTCACCTTTTACATGACTCAGGTGAAAAAACAGTATAA ACATTAATTTACTTTGTGTTCAAAAGAAAATTCCAACTGCTGTTGGGGAAGGACACAGAA AAGAAAAATAACCACCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004987 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004987.3, NP_004978.2 |
RefSeq Size | 1559 bp |
RefSeq ORF | 978 bp |
Locus ID | 3987 |
UniProt ID | P48059 |
Domains | LIM |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010] Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 2 and 3 both encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202765 | LIMS1 (Myc-DDK-tagged)-Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2 |
CNY 2400.00 |
|
RC202765L1 | Lenti ORF clone of Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC202765L2 | Lenti ORF clone of Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC202765L3 | Lenti ORF clone of Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC202765L4 | Lenti ORF clone of Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG202765 | LIMS1 (tGFP-tagged) - Human LIM and senescent cell antigen-like domains 1 (LIMS1), transcript variant 2 |
CNY 4000.00 |