GADD45GIP1 (NM_052850) Human Untagged Clone
CAT#: SC319775
GADD45GIP1 (untagged)-Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1)
CNY 2400.00
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CKBBP2; CKbetaBP2; CRIF1; MRP-L59; PLINP; PLINP-1; Plinp1; PRG6 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_052850.2
AGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCGACCCTGGCCC
CGGGTTCCCGTGGCTACCGGGCGCGGCCGCCCCCGCGCCGCAGGCCGGGACCCCGGTGGC CAGACCCCGAGGACCTCCTGACCCCGCGGTGGCAGCTGGGACCGCGCTACGCGGCTAAGC AGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGG AGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGC AGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGC ACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGC GGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGG CCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCC AGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGG AGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCAC CCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCAGTACCCCTGAAG AAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_052850 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_052850.2, NP_443082.2 |
RefSeq Size | 744 bp |
RefSeq ORF | 669 bp |
Locus ID | 90480 |
UniProt ID | Q8TAE8 |
Gene Summary | This gene encodes a nuclear-localized protein that may be induced by p53 and regulates the cell cycle by inhibiting G1 to S phase progression. The encoded protein may interact with other cell cycle regulators. [provided by RefSeq, Aug 2012] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209644 | GADD45GIP1 (Myc-DDK-tagged)-Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1) |
CNY 2400.00 |
|
RC209644L1 | Lenti ORF clone of Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1), Myc-DDK-tagged |
CNY 4800.00 |
|
RC209644L2 | Lenti ORF clone of Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1), mGFP tagged |
CNY 5890.00 |
|
RC209644L3 | Lenti ORF clone of Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1), Myc-DDK-tagged |
CNY 5890.00 |
|
RC209644L4 | Lenti ORF clone of Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1), mGFP tagged |
CNY 5890.00 |
|
RG209644 | GADD45GIP1 (tGFP-tagged) - Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1) |
CNY 4000.00 |
其它GADD45GIP1产品