GADD45GIP1 (NM_052850) Human Untagged Clone

CAT#: SC319775

GADD45GIP1 (untagged)-Human growth arrest and DNA-damage-inducible, gamma interacting protein 1 (GADD45GIP1)



  "NM_052850" in other vectors (6)

CNY 2400.00

CNY 3990.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GADD45GIP1 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CKBBP2; CKbetaBP2; CRIF1; MRP-L59; PLINP; PLINP-1; Plinp1; PRG6
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_052850.2 AGATGGCGGCGTCCGTGCGACAGGCACGCAGCCTACTAGGTGTGGCGGCGACCCTGGCCC
CGGGTTCCCGTGGCTACCGGGCGCGGCCGCCCCCGCGCCGCAGGCCGGGACCCCGGTGGC
CAGACCCCGAGGACCTCCTGACCCCGCGGTGGCAGCTGGGACCGCGCTACGCGGCTAAGC
AGTTCGCGCGTTACGGCGCCGCCTCCGGGGTGGTCCCCGGTTCGTTATGGCCGTCGCCGG
AGCAGCTGCGGGAGCTGGAGGCCGAAGAACGCGAATGGTACCCGAGCCTGGCGACCATGC
AGGAGTCGCTGCGGGTGAAGCAGCTGGCCGAAGAGCAGAAGCGTCGGGAGAGGGAGCAGC
ACATCGCAGAGTGCATGGCCAAGATGCCACAGATGATTGTGAACTGGCAGCAGCAGCAGC
GGGAGAACTGGGAGAAGGCCCAGGCTGACAAGGAGAGGAGGGCCCGACTGCAGGCTGAGG
CCCAGGAGCTCCTGGGCTACCAGGTGGACCCAAGGAGTGCCCGCTTCCAGGAGCTGCTCC
AGGACCTAGAGAAGAAGGAGCGCAAGCGCCTCAAGGAGGAAAAACAGAAACGGAAGAAGG
AGGCGCGAGCTGCTGCATTGGCTGCAGCTGTGGCTCAAGACCCAGCAGCCTCTGGGGCAC
CCAGCTCCTGAGGCTTTGTCCCTTCCCAATAAAGCCTGCTACCTGGCAGTACCCCTGAAG
AAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_052850
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_052850.2, NP_443082.2
RefSeq Size 744 bp
RefSeq ORF 669 bp
Locus ID 90480
UniProt ID Q8TAE8
Gene Summary This gene encodes a nuclear-localized protein that may be induced by p53 and regulates the cell cycle by inhibiting G1 to S phase progression. The encoded protein may interact with other cell cycle regulators. [provided by RefSeq, Aug 2012]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...