Carbonic Anhydrase I (CA1) (NM_001738) Human Untagged Clone
CAT#: SC321710
CA1 (untagged)-Human carbonic anhydrase I (CA1), transcript variant 2
CNY 2400.00
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CA-I; CAB; Car1; HEL-S-11 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001738.1
CAGTCCTCAGGTGCAACCCCCTGCGTGGTCCTCTGTGGCAGCCTTCTCTCATTCAGAGCT
AAAAAGAAAACTCAGTAGAAGATAATGGCAAGTCCAGACTGGGGATATGATGACAAAAAT GGTCCTGAACAATGGAGCAAGCTGTATCCCATTGCCAATGGAAATAACCAGTCCCCTGTT GATATTAAAACCAGTGAAACCAAACATGACACCTCTCTGAAACCTATTAGTGTCTCCTAC AACCCAGCCACAGCCAAAGAAATTATCAATGTGGGGCATTCCTTCCATGTAAATTTTGAG GACAACGATAACCGATCAGTGCTGAAAGGTGGTCCTTTCTCTGACAGCTACAGGCTCTTT CAGTTCCATTTTCACTGGGGCAGTACAAATGAGCATGGTTCAGAACATACAGTGGATGGA GTCAAATATTCTGCCGAGCTTCACGTAGCTCACTGGAATTCTGCAAAGTACTCCAGCCTT GCTGAAGCTGCCTCAAAGGCTGATGGTTTGGCAGTTATTGGTGTTTTGATGAAGGTTGGT GAGGCCAACCCAAAGCTGCAGAAAGTACTTGATGCCCTCCAAGCAATTAAAACCAAGGGC AAACGAGCCCCATTCACAAATTTTGACCCCTCTACTCTCCTTCCTTCATCCCTGGATTTC TGGACCTACCCTGGCTCTCTGACTCATCCTCCTCTTTATGAGAGTGTAACTTGGATCATC TGTAAGGAGAGCATCAGTGTCAGCTCAGAGCAGCTGGCACAATTCCGCAGCCTTCTATCA AATGTTGAAGGTGATAACGCTGTCCCCATGCAGCACAACAACCGCCCAACCCAACCTCTG AAGGGCAGAACAGTGAGAGCTTCATTTTGATGATTCTGAGAAGAAACTTGTCCTTCCTCA AGAACACAGCCCTGCTTCTGACATAATCCAGTAAAATAATAATTTTTAAGAAATAAATTT ATTTCAATATTAGCAAGACAGCATGCCTTCAAATCAATCTGTAAAACTAAGAAACTTAAA TTTTAGTTCTTACTGCTTAATTCAAATAATAATTAGTAAGCTAGCAAATAGTAATCTGTA AGCATAAGCTTATGCTTAAATTCAAGTTTAGTTTGAGGAATTCTTTAAAATTACAACTAA GTGATTTGTATGTCTATTTTTTTCAGTTTATTTGAACCAATAAAATAATTTTATCTCTTT AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001738 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001738.1, NP_001729.1 |
RefSeq Size | 1264 bp |
RefSeq ORF | 786 bp |
Locus ID | 759 |
UniProt ID | P00915 |
Domains | carb_anhydrase |
Protein Families | Druggable Genome |
Protein Pathways | Nitrogen metabolism |
Gene Summary | Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This CA1 gene is closely linked to the CA2 and CA3 genes on chromosome 8. It encodes a cytosolic protein that is found at the highest level in erythrocytes. Allelic variants of this gene have been described in some populations. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Nov 2016] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 3. Variants 1, 2, 3, 4 and 5 all encode isoform a. This variant represents use of an upstream long terminal repeat (LTR) promoter and exon sequence, and results in erythroid expression. (PMID: 1908227). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC206616 | CA1 (Myc-DDK-tagged)-Human carbonic anhydrase I (CA1), transcript variant 2 |
CNY 2400.00 |
|
RC206616L1 | Lenti ORF clone of Human carbonic anhydrase I (CA1), transcript variant 2, Myc-DDK-tagged |
CNY 4800.00 |
|
RC206616L2 | Lenti ORF clone of Human carbonic anhydrase I (CA1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RC206616L3 | Lenti ORF clone of Human carbonic anhydrase I (CA1), transcript variant 2, Myc-DDK-tagged |
CNY 5890.00 |
|
RC206616L4 | Lenti ORF clone of Human carbonic anhydrase I (CA1), transcript variant 2, mGFP tagged |
CNY 5890.00 |
|
RG206616 | CA1 (tGFP-tagged) - Human carbonic anhydrase I (CA1), transcript variant 2 |
CNY 4000.00 |
其它Carbonic Anhydrase I产品