LSM5 (NM_001130710) Human Untagged Clone

CAT#: SC324688

LSM5 (untagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 2



  "NM_001130710" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-LSM5 Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms YER146W
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130710, the custom clone sequence may differ by one or more nucleotides
ATGAAGAGTGATAAGGAAATTGTTGGTACTCTTCTAGGATTTGATGACTTTGTCAATATG
GTACTGGAAGATGTCACTGAGTTTGAAATCACACCAGAAGGAAGAAGGATTACTAAATTA
GATCAGATTTTGCTAAATGGAAATAATATAACAATGCTGGTTCCTGGAGGAGAAGGACCT
GAAGTG
Restriction Sites Please inquire     
ACCN NM_001130710
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130710.1, NP_001124182.1
RefSeq Size 2212 bp
RefSeq ORF 189 bp
Locus ID 23658
UniProt ID Q9Y4Y9
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation, Spliceosome
Gene Summary Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a segment of the 5' coding region, and uses a downstream translation initiation codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...