United States
Germany
Japan
United Kingdom
China
SRP9 (NM_001130440) Human Untagged Clone
CAT＃: SC324701
SRP9 (untagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALURBP |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001130440, the custom clone sequence may differ by one or more nucleotides
ATGCCGCAGTACCAGACCTGGGAGGAGTTCAGCCGCGCTGCCGAGAAGCTTTACCTCGCT GACCCTATGAAGGCACGTGTGGTTCTCAAATATAGGCATTCTGATGGGAACTTGTGTGTT AAAGTAACAGATGATTTAGTTAGACAGTGTCTTGCTCTATTGCTCAGGCTGCAGTGCAGT GGCATGATCATAGCTCACTGCATCCTCGACCTCCTGGGCTCAAGCGGTCCTCTTGCTTCA GCCTCC |
| Restriction Sites | Please inquire |
| ACCN | NM_001130440 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001130440.1, NP_001123912.1 |
| RefSeq Size | 1648 bp |
| RefSeq ORF | 249 bp |
| Locus ID | 6726 |
| UniProt ID | P49458 |
| Protein Families | Druggable Genome |
| Protein Pathways | Protein export |
| Gene Summary | Signal-recognition-particle assembly has a crucial role in targeting secretory proteins to the rough endoplasmic reticulum membrane. SRP9 together with SRP14 and the Alu portion of the SRP RNA, constitutes the elongation arrest domain of SRP. The complex of SRP9 and SRP14 is required for SRP RNA binding.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) is the longer transcript but encodes the shorter isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225000 | SRP9 (Myc-DDK-tagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1 |
CNY 3,990.00 |
|
| RC225000L3 | Lenti-ORF clone of SRP9 (Myc-DDK-tagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1 |
CNY 5,890.00 |
|
| RC225000L4 | Lenti-ORF clone of SRP9 (mGFP-tagged)-Human signal recognition particle 9kDa (SRP9), transcript variant 1 |
CNY 5,890.00 |
|
| RG225000 | SRP9 (tGFP-tagged) - Human signal recognition particle 9kDa (SRP9), transcript variant 1 |
CNY 4,370.00 |
