MTLRP (GHRL) (NM_001134941) Human Untagged Clone

CAT#: SC324715

GHRL (untagged)-Human ghrelin/obestatin prepropeptide (GHRL), transcript variant 2



  "NM_001134941" in other vectors (4)

CNY 3990.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
GHRL Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MTLRP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001134941, the custom clone sequence may differ by one or more nucleotides
ATGCCCTCCCCAGGGACCGTCTGCAGCCTCCTGCTCCTCGGCATGCTCTGGCTGGACTTG
GCCATGGCAGGCTCCAGCTTCCTGAGCCCTGAACACCAGAGAGTCCAGAGAAAGGAGTCG
AAGAAGCCACCAGCCAAGCTGCAGCCCCGAGCTCTAGCAGGCTGGCTCCGCCCGGAAGAT
GGAGGTCAAGCAGAAGGGGCAGAGGATGAACTGGAAGTCCGGTTCAACGCCCCCTTTGAT
GTTGGAATCAAGCTGTCAGGGGTTCAGTACCAGCAGCACAGCCAGGCCCTGGGGAAGTTT
CTTCAGGACATCCTCTGGGAAGAGGCCAAAGAGGCCCCAGCCGACAAG
Restriction Sites Please inquire     
ACCN NM_001134941
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001134941.1, NP_001128413.1
RefSeq Size 549 bp
RefSeq ORF 351 bp
Locus ID 51738
UniProt ID Q9UBU3
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Gene Summary This gene encodes the ghrelin-obestatin preproprotein that is cleaved to yield two peptides, ghrelin and obestatin. Ghrelin is a powerful appetite stimulant and plays an important role in energy homeostasis. Its secretion is initiated when the stomach is empty, whereupon it binds to the growth hormone secretagogue receptor in the hypothalamus which results in the secretion of growth hormone (somatotropin). Ghrelin is thought to regulate multiple activities, including hunger, reward perception via the mesolimbic pathway, gastric acid secretion, gastrointestinal motility, and pancreatic glucose-stimulated insulin secretion. It was initially proposed that obestatin plays an opposing role to ghrelin by promoting satiety and thus decreasing food intake, but this action is still debated. Recent reports suggest multiple metabolic roles for obestatin, including regulating adipocyte function and glucose metabolism. Alternative splicing results in multiple transcript variants. In addition, antisense transcripts for this gene have been identified and may potentially regulate ghrelin-obestatin preproprotein expression. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1. The resulting isoform (2) contains the ligands ghrelin-27, which lacks a single amino acid compared to ghrelin-28 found in isoform 1, and obestatin. Variants 2 and 10 encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...