AIF (AIFM1) (NM_001130846) Human Untagged Clone

CAT#: SC324863

AIFM1 (untagged)-Human apoptosis-inducing factor, mitochondrion-associated, 1 (AIFM1), transcript variant 4



  "NM_001130846" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
AIFM1 mouse monoclonal antibody,clone OTI4E6
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AIF; AUNX1; CMT2D; CMTX4; COWCK; COXPD6; DFNX5; NADMR; NAMSD; PDCD8; SEMDHL
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001130846, the custom clone sequence may differ by one or more nucleotides
ATGGAAAAAGTCAGACGAGAGGGGGTTAAGGTGATGCCCAATGCTATTGTGCAATCCGTT
GGAGTCAGCAGTGGCAAGTTACTTATCAAGCTGAAAGACGGCAGGAAGGTAGAAACTGAC
CACATAGTGGCAGCTGTGGGCCTGGAGCCCAATGTTGAGTTGGCCAAGACTGGTGGCCTG
GAAATAGACTCAGATTTTGGTGGCTTCCGGGTAAATGCAGAGCTACAAGCACGCTCTAAC
ATCTGGGTGGCAGGAGATGCTGCATGCTTCTACGATATAAAGTTGGGAAGGAGGCGGGTA
GAGCACCATGATCACGCTGTTGTGAGTGGAAGATTGGCTGGAGAAAATATGACTGGAGCT
GCTAAGCCGTACTGGCATCAGTCAATGTTCTGGAGTGATTTGGGCCCCGATGTTGGCTAT
GAAGCTATTGGTCTTGTGGACAGTAGTTTGCCCACAGTTGGTGTTTTTGCAAAAGCAACT
GCACAAGACAACCCCAAATCTGCCACAGAGCAGTCAGGAACTGGTATCCGATCAGAGAGT
GAGACAGAGTCCGAGGCCTCAGAAATTACTATTCCTCCCAGCACCCCGGCAGTTCCACAG
GCTCCCGTCCAGGGGGAGGACTACGGCAAAGGTGTCATCTTCTACCTCAGGGACAAAGTG
GTCGTGGGGATTGTGCTATGGAACATCTTTAACCGAATGCCAATAGCAAGGAAGATCATT
AAGGACGGTGAGCAGCATGAAGATCTCAATGAAGTAGCCAAACTATTCAACATTCATGAA
GAC
Restriction Sites Please inquire     
ACCN NM_001130846
Insert Size 1942 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130846.1, NP_001124318.1
RefSeq Size 1942 bp
RefSeq ORF 786 bp
Locus ID 9131
UniProt ID O95831
Protein Families Druggable Genome, Transmembrane
Protein Pathways Apoptosis
Gene Summary This gene encodes a flavoprotein essential for nuclear disassembly in apoptotic cells, and it is found in the mitochondrial intermembrane space in healthy cells. Induction of apoptosis results in the translocation of this protein to the nucleus where it affects chromosome condensation and fragmentation. In addition, this gene product induces mitochondria to release the apoptogenic proteins cytochrome c and caspase-9. Mutations in this gene cause combined oxidative phosphorylation deficiency 6 (COXPD6), a severe mitochondrial encephalomyopathy, as well as Cowchock syndrome, also known as X-linked recessive Charcot-Marie-Tooth disease-4 (CMTX-4), a disorder resulting in neuropathy, and axonal and motor-sensory defects with deafness and cognitive disability. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 10. [provided by RefSeq, Aug 2015]
Transcript Variant: This variant (4) lacks several 5' exons but contains an alternate 5' terminal exon, and it thus differs in the 5' UTR and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (AIFsh, also known as AIFshort) is shorter at the N-terminus, compared to isoform AIF. This variant can initiate translation at alternative start codons according to protein N-terminal sequencing and in vitro translation studies in PMID:16365034. The 5'-most start codon is represented in this RefSeq.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...