NEIL2 (NM_001135747) Human Untagged Clone
CAT#: SC324871
NEIL2 (untagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 3
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NEH2; NEI2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001135747, the custom clone sequence may differ by one or more nucleotides
ATGGGGCCCCCTGGCAGCAGCCCAACACCAGAGCCTCCACAAAAAGAAGTGCAGAAGGAA GGGGCTGCGGACCCAAAGCAGGTCGGGGAGCCCAGCGGGCAGAAGACCCTTGATGGATCC TCACGGTCTGCAGAGCTCGTCCCCCAGGGCGAGGATGATTCTGAGTATTTGGAGAGAGAC GCCCCTGCAGGAGATGCTGGGAGGTGGCTGCGTGTCAGCTTTGGTTTGTTTGGCAGCGTT TGGGTGAACGATTTCTCCAGAGCCAAGAAAGCCAACAAGAGGGGGGACTGGAGGGACCCT TCCCCGAGGTTGGTCCTGCACTTTGGTGGTGGTGGCTTCCTGGCATTTTATAATTGTCAG TTGTCTTGGAGCTCTTCCCCAGTGGTCACACCCACCTGTGACATCCTGTCTGAGAAGTTC CATCGAGGACAAGCCTTAGAAGCTCTAGGCCAGGCTCAGCCTGTCTGCTATACACTGCTG GACCAGAGATACTTCTCAGGGCTAGGGAACATCATTAAGAATGAAGCCTTGTACAGAGCT GGGATCCATCCCCTTTCTCTCGGTTCAGTCCTGAGTGCCTCGCGTCGGGAGGTCCTGGTG GATCACGTGGTGGAGTTCAGTACAGCCTGGCTGCAGGGCAAGTTCCAAGGCAGACCGCAG CACACACAGGTCTACCAGAAAGAACAGTGCCCTGCTGGCCACCAGGTCATGAAGGAGGCG TTTGGGCCCGAAGATGGGTTACAGAGGCTCACCTGGTGGTGCCCGCAGTGCCAGCCCCAG TTGTCAGAGGAGCCAGAGCAGTGCCAGTTCTCC |
Restriction Sites | Please inquire |
ACCN | NM_001135747 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001135747.1, NP_001129219.1 |
RefSeq Size | 2062 bp |
RefSeq ORF | 816 bp |
Locus ID | 252969 |
UniProt ID | Q969S2 |
Protein Families | Druggable Genome |
Protein Pathways | Base excision repair |
Gene Summary | This gene encodes a member of the Fpg/Nei family of DNA glycosylases. These glycosylases initiate the first step in base excision repair by cleaving oxidatively damaged bases and introducing a DNA strand break via their abasic site lyase activity. This enzyme is primarily associated with DNA repair during transcription and acts prefentially on cytosine-derived lesions, particularly 5-hydroxyuracil and 5-hydroxycytosine. It contains an N-terminal catalytic domain, a hinge region, and a C-terminal DNA-binding domain with helix-two-turn-helix and zinc finger motifs. This enzyme interacts with the X-ray cross complementing factor 1 scaffold protein as part of a multi-protein DNA repair complex. A pseudogene of this gene has been identified. [provided by RefSeq, Mar 2017] Transcript Variant: This variant (3) differs in the 5' UTR, lacks an alternate exon in the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (b) has a shorter N-terminus compared to isoform a. Variants 3 and 5-7 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227916 | NEIL2 (Myc-DDK-tagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 3 |
CNY 3990.00 |
|
RC227916L3 | Lenti-ORF clone of NEIL2 (Myc-DDK-tagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 3 |
CNY 5890.00 |
|
RC227916L4 | Lenti-ORF clone of NEIL2 (mGFP-tagged)-Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 3 |
CNY 5890.00 |
|
RG227916 | NEIL2 (tGFP-tagged) - Human nei endonuclease VIII-like 2 (E. coli) (NEIL2), transcript variant 3 |
CNY 4370.00 |