IRAK4 (NM_001145257) Human Untagged Clone

CAT#: SC324957

IRAK4 (untagged)-Human interleukin-1 receptor-associated kinase 4 (IRAK4), transcript variant 4



  "NM_001145257" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
IRAK4 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IMD67; IPD1; IRAK-4; NY-REN-64; REN64
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001145257, the custom clone sequence may differ by one or more nucleotides
ATGCCTTTCTGTGACAAAGACAGGACATTGATGACACCTGTGCAGAATCTTGAACAAAGC
TATATGCCACCTGACTCCTCAAGTCCAGAAAATAAAAGTTTAGAAGTTAGTGATACACGT
TTTCACAGTTTTTCATTTTATGAATTGAAGAATGTCACAAATAACTTTGATGAACGACCC
ATTTCTGTTGGTGGTAATAAAATGGGAGAGGGAGGATTTGGAGTTGTATATAAAGGCTAC
GTAAATAACACAACTGTGGCAGTGAAGAAGCTTGCAGCAATGGTTGACATTACTACTGAA
GAACTGAAACAGCAGTTTGATCAAGAAATAAAAGTAATGGCAAAGTGTCAACATGAAAAC
TTAGTAGAACTACTTGGTTTCTCAAGTGATGGAGATGACCTCTGCTTAGTATATGTTTAC
ATGCCTAATGGTTCATTGCTAGACAGACTCTCTTGCTTGGATGGTACTCCACCACTTTCT
TGGCACATGAGATGCAAGATTGCTCAGGGTGCAGCTAATGGCATCAATTTTCTACATGAA
AATCATCATATTCATAGAGATATTAAAAGTGCAAATATCTTACTGGATGAAGCTTTTACT
GCTAAAATATCTGACTTTGGCCTTGCACGGGCTTCTGAGAAGTTTGCCCAGACAGTCATG
ACTAGCAGAATTGTGGGAACAACAGCTTATATGGCACCAGAAGCTTTGCGTGGAGAAATA
ACACCCAAATCTGATATTTACAGCTTTGGTGTGGTTTTACTAGAAATAATAACTGGACTT
CCAGCTGTGGATGAACACCGTGAACCTCAGTTATTGCTAGATATTAAAGAAGAAATTGAA
GATGAAGAAAAGACAATTGAAGATTATATTGATAAAAAGATGAATGATGCTGATTCCACT
TCAGTTGAAGCTATGTACTCTGTTGCTAGTCAATGTCTGCATGAAAAGAAAAATAAGAGA
CCAGACATTAAGAAGGTTCAACAGCTGCTGCAAGAGATGACAGCTTCT
Restriction Sites Please inquire     
ACCN NM_001145257
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145257.1, NP_001138729.1
RefSeq Size 4157 bp
RefSeq ORF 1011 bp
Locus ID 51135
UniProt ID Q9NWZ3
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Apoptosis, Neurotrophin signaling pathway, Toll-like receptor signaling pathway
Gene Summary This gene encodes a kinase that activates NF-kappaB in both the Toll-like receptor (TLR) and T-cell receptor (TCR) signaling pathways. The protein is essential for most innate immune responses. Mutations in this gene result in IRAK4 deficiency and recurrent invasive pneumococcal disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (4) lacks two alternate exons and uses a downstream start codon, compared to variant 1. The resulting isoform (b), also known as the short form, has a shorter N-terminus, compared to isoform a. Variants 3-10 all encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...