CD299 (CLEC4M) (NM_001144907) Human Untagged Clone

CAT#: SC325783

CLEC4M (untagged)-Human C-type lectin domain family 4, member M (CLEC4M), transcript variant 11



  "NM_001144907" in other vectors (2)

CNY 6270.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CLEC4M mouse monoclonal antibody,clone OTI10C3
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD209L; CD299; DC-SIGN2; DC-SIGNR; DCSIGNR; HP10347; L-SIGN; LSIGN
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001144907, the custom clone sequence may differ by one or more nucleotides
ATGAGTGACTCCAAGGAACCAAGGGTGCAGCAGCTGGGCCTCCTGGAAGAAGATCCAACA
ACCAGTGGCATCAGACTTTTTCCAAGAGACTTTCAATTCCAGCAGATACATGGCCACAAG
AGCTCTACAGTTCCTTTTCTTCTTGGCCCAGTGTCCAAGGTCCCCAGCTCCCTAAGTCAG
GAACAATCCGAGCAAGACGCAATCTACCAGAACCTGACCCAGCTTAAAGCTGCAGTGGGT
GAGCTCTCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTGACCCAGCTGAAGGCT
GCAGTGGGTGAGTTGCCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAGCTGACCCGG
CTGAAGGCTGCAGTGGGTGAGTTGCCAGAGAAATCCAAGCTGCAGGAGATCTACCAGGAG
CTGACCCGGCTGAAGGCTGCAGTGGGTGAGTTGCCAGAGAAATCCAAGCTGCAGGAGATC
TACCAGGAGCTGACGGAGCTGAAGGCTGCAGTGGGTGAGTTGCCAGAGAAATCCAAGCTG
CAGGAGATCTACCAGGAGCTGACCCAGCTGAAGGCTGCAGTGGAACGCCTGTGCCGCCAC
TGTCCCAAGGACTGGACATTCTTCCAAGGAAACTGTTACTTCATGTCTAACTCCCAGCGG
AACTGGCACGACTCCGTCACCGCCTGCCAGGAAGTGAGGGCCCAGCTCGTCGTAATCAAA
ACTGCTGAGGAGCAGAACTTCCTACAGCTGCAGACTTCCAGGAGTAACCGCTTCTCCTGG
ATGGGACTTTCAGACCTAAATCAGGAAGGCACGTGGCAATGGGTGGACGGCTCACCTCTG
TCACCCAGCTTCCAGCGGTACTGGAACAGTGGAGAACCCAACAATAGCGGGAATGAAGAC
TGTGCGGAATTTAGTGGCAGTGGCTGGAACGACAATCGATGTGACGTTGACAATTACTGG
ATCTGCAAAAAGCCCGCAGCCTGCTTCAGAGACGAA
Restriction Sites Please inquire     
ACCN NM_001144907
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001144907.1, NP_001138379.1
RefSeq Size 1775 bp
RefSeq ORF 999 bp
Locus ID 10332
UniProt ID Q9H2X3
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a C-type lectin that functions in cell adhesion and pathogen recognition. This receptor recognizes a wide range of evolutionarily divergent pathogens with a large impact on public health, including tuberculosis mycobacteria, and viruses including Ebola, hepatitis C, HIV-1, influenza A, West Nile virus and the SARS-CoV acute respiratory syndrome coronavirus. The protein is organized into four distinct domains: a C-terminal carbohydrate recognition domain, a flexible tandem-repeat neck domain of variable length, a transmembrane region and an N-terminal cytoplasmic domain involved in internalization. This gene is closely related in terms of both sequence and function to a neighboring gene, CD209 (Gene ID: 30835), also known as DC-SIGN. The two genes differ in viral recognition and expression patterns, with this gene showing high expression in endothelial cells of the liver, lymph node and placenta. Polymorphisms in the tandem repeat neck domain are associated with resistance to SARS infection. [provided by RefSeq, May 2020]
Transcript Variant: This variant (11) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The resulting protein (isoform 11) has a distinct C-terminus and is shorter than isoform 1. The encoded isoform (11) lacks a transmembrane domain and has 5.5 repeats in the neck domain.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...