RBFOX1 (NM_001142333) Human Untagged Clone
CAT#: SC325835
RBFOX1 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5
CNY 6080.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 2BP1; A2BP1; FOX-1; FOX1; HRNBP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC325835 representing NM_001142333.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAATTGTGAAAGAGAGCAGCTAAGGGGTAATCAGGAAGCAGCCGCTGCCCCTGACACAATGGCTCAG CCTTACGCTTCGGCCCAGTTTGCTCCCCCGCAGAACGGTATCCCCGCGGAATACACGGCCCCTCATCCC CACCCCGCGCCAGAGTACACAGGCCAGACCACGGTTCCCGAGCACACATTAAACCTGTACCCTCCCGCC CAGACGCACTCCGAGCAGAGCCCGGCGGACACGAGCGCTCAGACCGTCTCTGGCACCGCCACACAGACA GATGACGCAGCACCGACGGATGGCCAGCCCCAGACACAACCTTCTGAAAACACGGAAAACAAGTCTCAG CCCAAGCGGCTGCATGTCTCCAATATCCCCTTCAGGTTCCGGGATCCGGACCTCAGACAAATGTTTGGT CAATTTGGTAAAATCTTAGATGTTGAAATTATTTTTAATGAGCGAGGCTCAAAGGGATTTGGTTTCGTA ACTTTCGAAAATAGTGCCGATGCGGACAGGGCGAGGGAGAAATTACACGGCACCGTGGTAGAGGGCCGT AAAATCGAGGTAAATAATGCCACAGCACGTGTAATGACAAATAAAAAGACCGTCAACCCTTATACAAAT GGCTGGAAATTGAATCCAGTTGTGGGTGCAGTCTACAGTCCCGAATTCTATGCAGTGCCAGGCTTCCCG TATCCAGCAGCCACCGCCGCGGCCGCCTACCGAGGGGCGCACCTGCGAGGCCGCGGTCGCACCGTGTAC AACACCTTCAGGGCCGCGGCGCCCCCGCCCCCGATCCCGGCCTACGGCGGTGTTGTTTACCAGGATGGA TTTTATGGTGCAGACATTTATGGTGGTTATGCTGCATACCGCTACGCCCAGCCTACCCCTGCCACTGCC GCTGCCTACAGTGACAGTTACGGACGAGTTTATGCTGCCGACCCCTACCACCACGCACTTGCTCCAGCC CCCACCTACGGCGTTGGTGCCATGAATGCTTTTGCACCTTTGACTGATGCCAAGACTAGGAGCCATGCT GATGATGTGGGTCTCGTTCTTTCTTCATTGCAGGCTAGTATATACCGAGGGGGATACAACCGTTTTGCT CCATACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001142333 |
Insert Size | 1113 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142333.1 |
RefSeq Size | 4694 bp |
RefSeq ORF | 1113 bp |
Locus ID | 54715 |
UniProt ID | Q9NWB1 |
MW | 40 kDa |
Gene Summary | The Fox-1 family of RNA-binding proteins is evolutionarily conserved, and regulates tissue-specific alternative splicing in metazoa. Fox-1 recognizes a (U)GCAUG stretch in regulated exons or in flanking introns. The protein binds to the C-terminus of ataxin-2 and may contribute to the restricted pathology of spinocerebellar ataxia type 2 (SCA2). Ataxin-2 is the product of the SCA2 gene which causes familial neurodegenerative diseases. Fox-1 and ataxin-2 are both localized in the trans-Golgi network. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (5) differs in the 5' UTR and has multiple coding region differences compared to variant 1. The resulting isoform (5) has a shorter and distinct N-terminus and other internal differences compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227923 | RBFOX1 (Myc-DDK-tagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5 |
CNY 3656.00 |
|
RC227923L1 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5, Myc-DDK-tagged |
CNY 6056.00 |
|
RC227923L2 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5, mGFP tagged |
CNY 5890.00 |
|
RC227923L3 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5, Myc-DDK-tagged |
CNY 5890.00 |
|
RC227923L4 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5, mGFP tagged |
CNY 5890.00 |
|
RG227923 | RBFOX1 (tGFP-tagged) - Human RNA binding protein, fox-1 homolog (C. elegans) 1 (RBFOX1), transcript variant 5 |
CNY 4370.00 |