GNAL (NM_001142339) Human Untagged Clone

CAT#: SC325854

GNAL (untagged)-Human guanine nucleotide binding protein (G protein), alpha activating activity polypeptide, olfactory type (GNAL), transcript variant 3



  "NM_001142339" in other vectors (4)

CNY 6180.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
GNAL mouse monoclonal antibody,clone OTI1C11, Biotinylated
    • 100 ul

CNY 3990.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DYT25
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325854 representing NM_001142339.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGTGTTTGGGCGGCAACAGCAAGACGACGGAAGACCAGGGCGTCGATGAAAAAGAACGACGCGAG
GCCAACAAAAAGATCGAGAAGCAGTTGCAGAAAGAGCGCCTGGCTTACAAGGCTACCCACCGCCTGCTG
CTCCTGGGGGCTGGTGAGTCTGGGAAAAGCACTATCGTCAAACAGATGAGGATCCTGCACGTCAATGGG
TTTAATCCCGAGGAAAAGAAACAGAAAATTCTGGACATCCGGAAAAATGTTAAAGATGCTATCGTGACA
ATTGTTTCAGCAATGAGTACTATAATACCTCCAGTTCCGCTGGCCAACCCTGAAAACCAATTTCGATCA
GACTACATCAAGAGCATAGCCCCTATCACTGACTTTGAATATTCCCAGGAATTCTTTGACCATGTGAAA
AAACTTTGGGACGATGAAGGCGTGAAGGCATGCTTTGAGAGATCCAACGAATACCAGCTGATTGACTGT
GCACAATACTTCCTGGAAAGAATCGACAGCGTCAGCTTGGTTGACTACACACCCACAGACCAGGACCTC
CTCAGATGCAGAGTTCTGACATCTGGGATTTTTGAGACACGATTCCAAGTGGACAAAGTAAACTTCCAC
ATGTTTGATGTTGGTGGCCAGAGGGATGAGAGGAGAAAATGGATCCAGTGCTTTAACGATGTCACAGCT
ATCATTTACGTCGCAGCCTGCAGTAGCTACAACATGGTGATTCGAGAAGATAACAACACCAACAGGCTG
AGAGAGTCCCTGGATCTTTTTGAAAGCATCTGGAACAACAGGTGGTTACGGACCATTTCTATCATCTTG
TTCTTGAACAAACAAGATATGCTGGCAGAAAAAGTCTTGGCAGGGAAATCAAAAATTGAAGACTATTTC
CCAGAATATGCAAATTATACTGTTCCTGAAGACGCAACACCAGATGCAGGAGAAGATCCCAAAGTTACA
AGAGCCAAGTTCTTTATCCGGGACCTGTTTTTGAGGATCAGCACGGCCACCGGTGACGGCAAACATTAC
TGCTACCCGCACTTCACCTGCGCCGTGGACACAGAGAACATCCGCAGGGTGTTCAACGACTGCCGCGAC
ATCATCCAGCGGATGCACCTCAAGCAGTATGAGCTCTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142339
Insert Size 1146 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142339.2
RefSeq Size 6048 bp
RefSeq ORF 1146 bp
Locus ID 2774
UniProt ID P38405
Protein Families Druggable Genome
Protein Pathways Calcium signaling pathway, Olfactory transduction
MW 44.3 kDa
Gene Summary This gene encodes a stimulatory G protein alpha subunit which mediates odorant signaling in the olfactory epithelium. This protein couples dopamine type 1 receptors and adenosine A2A receptors and is widely expressed in the central nervous system. Mutations in this gene have been associated with dystonia 25 and this gene is located in a susceptibility region for bipolar disorder and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
Transcript Variant: This variant (3) differs in the 5' UTR and initiates translation at an alternate start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (2), which is shorter and has a distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...