PDK3 (NM_001142386) Human Untagged Clone

CAT#: SC325896

PDK3 (untagged)-Human pyruvate dehydrogenase kinase, isozyme 3 (PDK3), nuclear gene encoding mitochondrial protein, transcript variant 1



  "NM_001142386" in other vectors (4)

CNY 3656.00

CNY 6650.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Antibody against PDK3 (N-term)
    • 400 ul

CNY 6314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CMTX6; GS1-358P8.4
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001142386 edited
ATGCGGCTGTTCCGGTGGCTGCTGAAGCAGCCGGTGCCCAAGCAGATCGAGCGCTACTCG
CGCTTTTCGCCGTCGCCGCTCTCCATCAAACAATTCCTGGACTTCGGGAGAGATAATGCA
TGTGAGAAAACTTCATATATGTTTCTACGAAAGGAACTTCCTGTGCGGCTGGCTAACACA
ATGAGAGAAGTTAATCTTCTGCCGGATAATTTACTTAACCGCCCTTCAGTGGGATTGGTT
CAGAGTTGGTATATGCAGAGTTTTCTTGAACTTTTAGAATATGAAAATAAGAGCCCTGAG
GATCCACAGGTCTTGGATAACTTTCTACAAGTTCTGATTAAAGTCAGAAATAGACACAAT
GATGTGGTTCCTACAATGGCACAAGGAGTGATTGAATACAAGGAGAAGTTTGGGTTTGAT
CCTTTCATTAGCACTAACATCCAATATTTTCTGGATCGGTTTTATACCAACCGCATCTCT
TTCCGCATGCTTATTAATCAGCACACACTTCTGTTTGGGGGTGACACTAATCCTGTTCAT
CCTAAACACATAGGAAGTATCGATCCCACCTGTAACGTGGCGGATGTGGTGAAAGATGCA
TATGAAACAGCCAAGATGCTGTGTGAACAGTATTACCTGGTAGCTCCAGAGCTGGAAGTT
GAAGAATTCAATGCCAAAGCGCCAGACAAACCTATTCAGGTGGTTTATGTGCCCTCACAT
CTGTTTCATATGCTATTTGAGTTGTTCAAGAACTCAATGAGAGCGACAGTTGAACTCTAT
GAAGACAGAAAAGAGGGCTACCCTGCTGTTAAAACCCTCGTTACTTTGGGTAAAGAAGAC
TTATCCATTAAGATCAGTGACCTAGGTGGTGGTGTCCCACTTCGAAAAATAGATCGTCTT
TTTAACTACATGTATTCTACTGCTCCTAGACCCAGCCTGGAGCCTACCAGAGCTGCCCCT
TTGGCTGGATTTGGTTATGGTTTGCCAATTTCCCGTCTGTATGCTAGATATTTTCAAGGA
GATCTGAAACTGTATTCCATGGAAGGAGTGGGTACTGATGCTGTCATTTATTTGAAGGCT
CTTTCAAGTGAGTCATTTGAGAGACTTCCAGTTTTTAATAAGTCCGCATGGCGCCATTAC
AAGACCACGCCTGAAGCCGATGATTGGAGCAATCCCAGCAGTGAACCCAGGGATGCTTCA
AAATACAAAGCAAAACAAGACAAGATCAAGACTAATAGAACTTTCTAG
Restriction Sites Please inquire     
ACCN NM_001142386
Insert Size 2300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001142386.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142386.1, NP_001135858.1
RefSeq Size 2162 bp
RefSeq ORF 1248 bp
Locus ID 5165
UniProt ID Q15120
Protein Families Druggable Genome, Protein Kinase
Gene Summary The pyruvate dehydrogenase (PDH) complex is a nuclear-encoded mitochondrial multienzyme complex that catalyzes the overall conversion of pyruvate to acetyl-CoA and CO(2). It provides the primary link between glycolysis and the tricarboxylic acid (TCA) cycle, and thus is one of the major enzymes responsible for the regulation of glucose metabolism. The enzymatic activity of PDH is regulated by a phosphorylation/dephosphorylation cycle, and phosphorylation results in inactivation of PDH. The protein encoded by this gene is one of the three pyruvate dehydrogenase kinases that inhibits the PDH complex by phosphorylation of the E1 alpha subunit. This gene is predominantly expressed in the heart and skeletal muscles. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Transcript Variant: This variant (1) encodes the longer isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...