TXNDC5 (NM_001145549) Human Untagged Clone
CAT#: SC326461
TXNDC5 (untagged)-Human thioredoxin domain containing 5 (endoplasmic reticulum) (TXNDC5), transcript variant 3, mRNA
CNY 6270.00
Product images

CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ENDOPDI; ERP46; HCC-2; HCC2; PDIA15; STRF8; UNQ364 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145549, the custom clone sequence may differ by one or more nucleotides
ATGGAAGATGCCAAAGTCTATGTGGCTAAAGTGGACTGCACGGCCCACTCCGACGTGTGC TCCGCCCAGGGGGTGCGAGGATACCCCACCTTAAAGCTTTTCAAGCCAGGCCAAGAAGCT GTGAAGTACCAGGGTCCTCGGGACTTCCAGACACTGGAAAACTGGATGCTGCAGACACTG AACGAGGAGCCAGTGACACCAGAGCCGGAAGTGGAACCGCCCAGTGCCCCCGAGCTCAAG CAAGGGCTGTATGAGCTCTCAGCAAGCAACTTTGAGCTGCACGTTGCACAAGGCGACCAC TTTATCAAGTTCTTCGCTCCGTGGTGTGGTCACTGCAAAGCCCTGGCTCCAACCTGGGAG CAGCTGGCTCTGGGCCTTGAACATTCCGAAACTGTCAAGATTGGCAAGGTTGATTGTACA CAGCACTATGAACTCTGCTCCGGAAACCAGGTTCGTGGCTATCCCACTCTTCTCTGGTTC CGAGATGGGAAAAAGGTGGATCAGTACAAGGGAAAGCGGGATTTGGAGTCACTGAGGGAG TACGTGGAGTCGCAGCTGCAGCGCACAGAGACTGGAGCGACGGAGACCGTCACGCCCTCA GAGGCCCCGGTGCTGGCAGCTGAGCCCGAGGCTGACAAGGGCACTGTGTTGGCACTCACT GAAAATAACTTCGATGACACCATTGCAGAAGGAATAACCTTCATCAAGTTTTATGCTCCA TGGTGTGGTCATTGTAAGACTCTGGCTCCTACTTGGGAGGAACTCTCTAAAAAGGAATTC CCTGGTCTGGCGGGGGTCAAGATCGCCGAAGTAGACTGCACTGCTGAACGGAATATCTGC AGCAAGTATTCGGTACGAGGCTACCCCACGTTATTGCTTTTCCGAGGAGGGAAGAAAGTC AGTGAGCACAGTGGAGGCAGAGACCTTGACTCGTTACACCGCTTTGTCCTGAGCCAAGCG AAAGACGAACTT |
Restriction Sites | Please inquire |
ACCN | NM_001145549 |
Insert Size | 3195 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145549.1, NP_001139021.1 |
RefSeq Size | 3195 bp |
RefSeq ORF | 3195 bp |
Locus ID | 81567 |
UniProt ID | Q8NBS9 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal endoplasmic reticulum (ER)-signal sequence, three catalytically active thioredoxin domains and a C-terminal ER-retention sequence. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S5 gene. [provided by RefSeq, Dec 2016] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting isoform (3) is shorter at the N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226706 | TXNDC5 (Myc-DDK-tagged)-Human thioredoxin domain containing 5 (endoplasmic reticulum) (TXNDC5), transcript variant 3 |
CNY 3990.00 |
|
RC226706L3 | Lenti-ORF clone of TXNDC5 (Myc-DDK-tagged)-Human thioredoxin domain containing 5 (endoplasmic reticulum) (TXNDC5), transcript variant 3 |
CNY 5890.00 |
|
RC226706L4 | Lenti-ORF clone of TXNDC5 (mGFP-tagged)-Human thioredoxin domain containing 5 (endoplasmic reticulum) (TXNDC5), transcript variant 3 |
CNY 5890.00 |
|
RG226706 | TXNDC5 (tGFP-tagged) - Human thioredoxin domain containing 5 (endoplasmic reticulum) (TXNDC5), transcript variant 3 |
CNY 4370.00 |