Stathmin 1 (STMN1) (NM_001145454) Human Untagged Clone
CAT#: SC326533
STMN1 (untagged)-Human stathmin 1/oncoprotein 18 (STMN1), transcript variant 4, mRNA
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf215; Lag; LAP18; OP18; PP17; PP19; PR22; SMN |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001145454, the custom clone sequence may differ by one or more nucleotides
ATGGCTTCTTCTGATATCCAGGTGAAAGAACTGGAGAAGCGTGCCTCAGGCCAGGCTTTT GAGCTGATTCTCAGCCCTCGGTCAAAAGAATCTGTTCCAGAATTCCCCCTTTCCCCTCCA AAGAAGAAGGATCTTTCCCTGGAGGAAATTCAGAAGAAATTAGAAGCTGCAGAAGAAAGA CGCAAGTCCCATGAAGCTGAGGTCTTGAAGCAGCTGGCTGAGAAACGAGAGCACGAGAAA GAAGTGCTTCAGAAGGCAATAGAAGAGAACAACAACTTCAGTAAAATGGCAGAAGAGAAA CTGACCCACAAAATGGAAGCTAATAAAGAGAACCGAGAGGCACAAATGGCTGCCAAACTG GAACGTTTGCGAGAGAAGATGTACTTCTGGACTCACGGGCCTGGGGCCCACCCAGCACAG ATCTCTGCTGAGCAATCTTGTCTCCACTCTGTTCCTGCCCTTTGCCCAGCCCTGGGCCTC CAATCTGCATTGATTACCTGGTCTGATCTCTCTCACCATCAC |
Restriction Sites | Please inquire |
ACCN | NM_001145454 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001145454.1, NP_001138926.1 |
RefSeq Size | 2265 bp |
RefSeq ORF | 525 bp |
Locus ID | 3925 |
UniProt ID | P16949 |
Protein Pathways | MAPK signaling pathway |
Gene Summary | This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (4) represents the longest transcript, and encodes the longer isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227355 | STMN1 (Myc-DDK-tagged)-Human stathmin 1 (STMN1), transcript variant 4 |
CNY 3990.00 |
|
RC227355L3 | Lenti-ORF clone of STMN1 (Myc-DDK-tagged)-Human stathmin 1 (STMN1), transcript variant 4 |
CNY 5890.00 |
|
RC227355L4 | Lenti-ORF clone of STMN1 (mGFP-tagged)-Human stathmin 1 (STMN1), transcript variant 4 |
CNY 5890.00 |
|
RG227355 | STMN1 (tGFP-tagged) - Human stathmin 1 (STMN1), transcript variant 4 |
CNY 4370.00 |
其它Stathmin 1产品