SAE1 (NM_001145714) Human Untagged Clone

CAT#: SC326542

SAE1 (untagged)-Human SUMO1 activating enzyme subunit 1 (SAE1), transcript variant 3, mRNA



  "NM_001145714" in other vectors (4)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SAE1 mouse monoclonal antibody, clone OTI6B11 (formerly 6B11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AOS1; HSPC140; SUA1; UBLE1A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC326542 representing NM_001145714.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGAGAAGGAGGAGGCTGGCGGCGGCATTAGCGAGGAGGAGGCGGCACAGTATGACCGGCAGATC
CGCCTGTGGGGACTGGAGGCCCAGAAACGGCTGCGGGCCTCTCGGGTGCTTCTTGTCGGCTTGAAAGGA
CTTGGGGCTGAAATTGCCAAGAATCTCATCTTGGCAGGAGTGAAAGGACTGACCATGCTGGATCACGAA
CAGGTAACTCCAGAAGATCCCGGAGCTCAGTTCTTGATTCGTACTGGGTCTGTTGGCCGAAATAGGGCT
GAAGCCTCTTTGGAGCGAGCTCAGAATCTCAACCCCATGGTGGATGTGAAGGTGGACACTGAGGATATA
GAGAAGAAACCAGAGTCATTTTTCACTCAATTCGATGCTGTGTGTCTGACTTGCTGCTCCAGGGATGTC
ATAGTTAAAGTTGACCAGATCTGTCACAAAAATAGCATCAAGTTCTTTACAGGAGATGTTTTTGGCTAC
CATGGATACACATTTGCCAATCTAGGAGAGCATGAGTTTGTAGAGGAGAAAACTAAAGTTGCCAAAGTT
AGCCAAGGAGTAGAAGATGGGCCCGACACCAAGAGAGCAAAACTTGATTCTTCTGAGACAACGATGGTC
AAAAAGAAGGTGGTCTTCTGCCCTGTTAAAGAAGCCCTGGAGGTGGACTGGAGCAGTGAGAAAGCAAAG
GCTGCTCTGAAGCGCACGACCTCCGACTACTTTCTCCTTCAAGGTACTGCTTCTCCGAGATGGCCCCAG
TGTGTGCGGTGGTTGGAGGGATTTTGGCACAGGAAATTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001145714
Insert Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001145714.1
RefSeq Size 2393 bp
RefSeq ORF 801 bp
Locus ID 10055
UniProt ID Q9UBE0
Protein Pathways Ubiquitin mediated proteolysis
MW 29.8 kDa
Gene Summary Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Transcript Variant: This variant (3) lacks an alternate exon, compared to variant 1, which causes a frameshift. The resulting protein (isoform b) has a distinct C-terminus and is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...