United States
Germany
Japan
United Kingdom
China
Z DNA binding protein (ZBP1) (NM_001160419) Human Untagged Clone
CAT＃: SC326815
ZBP1 (untagged)-Human Z-DNA binding protein 1 (ZBP1) transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C20orf183; DAI; DLM-1; DLM1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001160419, the custom clone sequence may differ by one or more nucleotides
ATGGCCCAGGCTCCTGCTGACCCGGGCAGAGAAGGCCACCTTGAACAAAGAATCCTGCAG GTGCTGACAGAGGCTGGCTCCCCGGTGAAACTTGCCCAGCTGGTGAAGGAATGCCAAGCA CCCAAGAGGGAGCTCAACCAAGTCCTCTACCGAATGAAAAAGGAGTTGAAAGTCTCCCTC ACATCCCCTGCCACCTGGTGCTTGGGCGGGACTGATCCTGAAGGCGAGGGTCCTGCAGAG CTGGCCTTGTCCAGCCCTGCCGAGAGGCCCCAGCAACATGCAGCTACAATTCCAGAGACC CCTGGCCCTCAGTTCAGCCAACAACGGGAGGAAGACATCTACAGGTTTCTCAAAGACAAT GGTCCCCAGAGGGCCCTGGTCATCGCCCAAGCACTGGGAATGAGGACAGCAAAAGATGTG AACCGAGACTTGTACAGGATGAAGAGCAGGCACCTTCTGGACATGGATGAGCAGTCCAAA GCATGGACGATTTACCGCCCAGAAGATTCTGGAAGAAGAGCAAAGTCAGCCTCAATTATT TACCAGCACAATCCAATCAACATGATCTGCCAGAATGGACCCAACAGCTGGATTTCCATT GCAAACTCCGAAGCCATCCAGATTGGACACGGGAACATCATTACAAGACAGACAGTCTCC AGGGAGGACGGTAAGTCACCCAAGAGAGCCCAGGGAGGGGACCTCGGTGGGGAGCCACCG GATCCTCTGGGTGGGGGCAAAGGG |
| Restriction Sites | Please inquire |
| ACCN | NM_001160419 |
| Insert Size | 1255 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001160419.1, NP_001153891.1 |
| RefSeq Size | 1255 bp |
| RefSeq ORF | 747 bp |
| Locus ID | 81030 |
| UniProt ID | Q9H171 |
| Protein Pathways | Cytosolic DNA-sensing pathway |
| Gene Summary | This gene encodes a Z-DNA binding protein. The encoded protein plays a role in the innate immune response by binding to foreign DNA and inducing type-I interferon production. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (4) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (d) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC228180 | ZBP1 (Myc-DDK-tagged)-Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
CNY 3,990.00 |
|
| RC228180L3 | Lenti-ORF clone of ZBP1 (Myc-DDK-tagged)-Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
CNY 5,890.00 |
|
| RC228180L4 | Lenti-ORF clone of ZBP1 (mGFP-tagged)-Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
CNY 5,890.00 |
|
| RG228180 | ZBP1 (tGFP-tagged) - Human Z-DNA binding protein 1 (ZBP1), transcript variant 4 |
CNY 4,370.00 |
