FXYD4 (NM_001184963) Human Untagged Clone
CAT#: SC328157
FXYD4 (untagged)-Human FXYD domain containing ion transport regulator 4 (FXYD4) transcript variant 2
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHIF |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184963, the custom clone sequence may differ by one or more nucleotides
ATGGAGAGAGTGACCCTGGCCCTTCTCCTACTGGCAGGCCTGACTGCCTTGGAAGCCAAT GACCCATTTGCCAATAAAGACGATCCCTTCTACTATGACTGGAAAAACCTGCAGCTGAGC GGACTGATCTGCGGAGGGCTCCTGGCCATTGCTGGGATCGCGGCAGTTCTGAGTGGCAAA TGCAAATGCAAGAGCAGCCAGAAGCAGCACAGTCCTGTACCTGAGAAGGCCATCCCACTC ATCACTCCAGGCTCTGCCACTACTTGCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001184963 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001184963.1, NP_001171892.1 |
RefSeq Size | 636 bp |
RefSeq ORF | 270 bp |
Locus ID | 53828 |
UniProt ID | P59646 |
Protein Families | Ion Channels: Other, Transmembrane |
Gene Summary | This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. FXYD4, originally named CHIF for channel-inducing factor, has been shown to modulate the properties of the Na,K-ATPase, as has FXYD2, also known as the gamma subunit of the Na,K-ATPase, and FXYD7. Transmembrane topology has been established for FXYD4 and two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. Alternatively spliced transcript variants encoding the same protein have been found.[provided by RefSeq, May 2010] Transcript Variant: This variant (2) represents use of an alternate splice acceptor site in the 5' UTR, as compared to variant 1. This variant is likely to only be found in individuals with the A allele of SNP rs10899795, which is polymorphic in most populations. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229519 | FXYD4 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 4 (FXYD4), transcript variant 2 |
CNY 1200.00 |
|
RC229519L3 | Lenti-ORF clone of FXYD4 (Myc-DDK-tagged)-Human FXYD domain containing ion transport regulator 4 (FXYD4), transcript variant 2 |
CNY 5890.00 |
|
RC229519L4 | Lenti-ORF clone of FXYD4 (mGFP-tagged)-Human FXYD domain containing ion transport regulator 4 (FXYD4), transcript variant 2 |
CNY 5890.00 |
|
RG229519 | FXYD4 (tGFP-tagged) - Human FXYD domain containing ion transport regulator 4 (FXYD4), transcript variant 2 |
CNY 4370.00 |