NDUFB4 (NM_001168331) Human Untagged Clone
CAT#: SC328191
NDUFB4 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex 4 15kDa (NDUFB4) nuclear gene encoding mitochondrial protein transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B15; CI-B15 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001168331, the custom clone sequence may differ by one or more nucleotides
ATGTCGTTCCCAAAGTATAAGCCGTCGAGCCTGCGCACTCTGCCTGAGACCCTCGACCCA GCCGAATACAACATATCTCCGGAAACCCGGCGGGCGCAAGCCGAGCGGTTGGCCATAAGA GCCCAGCTGAAACGAGAGTACCTGCTTCAGTACAACGATCCCAACCGCCGAGGGCTCATC GAAAATCCTGCCTTGCTTCGTTGGGCCTATGCAAGAACAATAAATGTCTATCCTAATTTC AGACCCACTCCTAAAAACTCACTCATGGGAGCTCTGTGTGGATTTGGGCCCCTCATCTTC ATTTATTATATTATCAAAACTGAGAGGGTAAGTATTCAGACCAGATGTTTAGTATTTGAG TGA |
Restriction Sites | Please inquire |
ACCN | NM_001168331 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001168331.1, NP_001161803.1 |
RefSeq Size | 1560 bp |
RefSeq ORF | 363 bp |
Locus ID | 4710 |
UniProt ID | O95168 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
Gene Summary | This gene encodes a non-catalytic subunit of the multisubunit NADH:ubiquinone oxidoreductase, the first enzyme complex in the mitochondrial electron transport chain (complex I). Mammalian complex I is composed of 45 different subunits and transfers electrons from NADH to ubiquinone. [provided by RefSeq, Dec 2009] Transcript Variant: This variant (2) includes an alternate segment, compared to variant 1, that causes a frameshift. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229553 | NDUFB4 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa (NDUFB4), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 3,990.00 |
|
RC229553L3 | Lenti-ORF clone of NDUFB4 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa (NDUFB4), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RC229553L4 | Lenti-ORF clone of NDUFB4 (mGFP-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa (NDUFB4), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 5,890.00 |
|
RG229553 | NDUFB4 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 4, 15kDa (NDUFB4), nuclear gene encoding mitochondrial protein, transcript variant 2 |
CNY 4,370.00 |