RRAS2 (NM_001177315) Human Untagged Clone
CAT＃: SC328194
RRAS2 (untagged)-Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2) transcript variant 4
CNY 3990.00
Product images
CNY 6281.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NS12; TC21 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_001177315, the custom clone sequence may differ by one or more nucleotides
ATGAGAGAACAGTATATGAGGACTGGCGAAGGCTTCCTGTTGGTCTTTTCAGTCACAGAT AGAGGCAGTTTTGAAGAAATCTATAAGTTTCAAAGACAGATTCTCAGAGTAAAGGATCGT GATGAGTTCCCAATGATTTTAATTGGTAATAAAGCAGATCTGGATCATCAAAGACAGGTA ACACAGGAAGAAGGACAACAGTTAGCACGGCAGCTTAAGGTAACATACATGGAGGCATCA GCAAAGATTAGGATGAATGTAGATCAAGCTTTCCATGAACTTGTCCGGGTTATCAGGAAA TTTCAAGAGCAGGAATGTCCTCCTTCACCAGAACCAACACGGAAAGAAAAAGACAAGAAA GGCTGCCATTGTGTCATTTTCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001177315 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001177315.1, NP_001170786.1 |
| RefSeq Size | 2186 bp |
| RefSeq ORF | 384 bp |
| Locus ID | 22800 |
| UniProt ID | P62070 |
| Protein Families | Druggable Genome |
| Protein Pathways | MAPK signaling pathway, Regulation of actin cytoskeleton, Tight junction |
| Gene Summary | This gene encodes a member of the R-Ras subfamily of Ras-like small GTPases. The encoded protein associates with the plasma membrane and may function as a signal transducer. This protein may play an important role in activating signal transduction pathways that control cell proliferation. Mutations in this gene are associated with the growth of certain tumors. Pseudogenes of this gene are found on chromosomes 1 and 2. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010] Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus compared to isoform a. Both variants 2 and 4 encode the same isoform (b). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC229556 | RRAS2 (Myc-DDK-tagged)-Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 4 |
CNY 3990.00 |
|
| RC229556L3 | Lenti-ORF clone of RRAS2 (Myc-DDK-tagged)-Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 4 |
CNY 5890.00 |
|
| RC229556L4 | Lenti-ORF clone of RRAS2 (mGFP-tagged)-Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 4 |
CNY 5890.00 |
|
| RG229556 | RRAS2 (tGFP-tagged) - Human related RAS viral (r-ras) oncogene homolog 2 (RRAS2), transcript variant 4 |
CNY 4370.00 |
