PAFAH1B2 (NM_001184748) Human Untagged Clone

CAT#: SC328203

PAFAH1B2 (untagged)-Human platelet-activating factor acetylhydrolase 1b catalytic subunit 2 (30kDa) (PAFAH1B2) transcript variant 4



  "NM_001184748" in other vectors (4)

CNY 3990.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PAFAH1B2 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-303
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184748, the custom clone sequence may differ by one or more nucleotides
ATGAGCCAAGGAGACTCAAACCCAGCAGCTATTCCGCATGCAGCAGAAGATATTCAAGGA
GATGACCGATGGATGTCTCAGCACAACAGATTTGTTTTGGACTGTAAAGACAAAGAGCCT
GATGTACTGTTCGTGGGAGACTCCATGGTGCAGTTAATGCAGCAATATGAGATATGGCGA
GAGCTTTTTTCCCCACTTCATGCACTGAATTTTGGAATTGGGGGAGATACAACAAGACAT
GTTTTGTGGAGACTAAAGAATGGAGAACTGGAGAATATTAAGCCTAAGGTCATTGTTGTC
TGGGTAGGAACAAATAACCACGAAAATACAGCAGAAGAAGTAGCAGGTGGGATCGAGGCC
ATTGTACAACTTATCAACACAAGGCAGCCACAGGCGTGA
Restriction Sites Please inquire     
ACCN NM_001184748
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184748.1, NP_001171677.1
RefSeq Size 2537 bp
RefSeq ORF 399 bp
Locus ID 5049
UniProt ID P68402
Protein Pathways Ether lipid metabolism, Metabolic pathways
Gene Summary Platelet-activating factor acetylhydrolase (PAFAH) inactivates platelet-activating factor (PAF) into acetate and LYSO-PAF. This gene encodes the beta subunit of PAFAH, the other subunits are alpha and gamma. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jan 2014]
Transcript Variant: This variant (4) contains a different segment for its 3' end, compared to variant 1. The resulting protein (isoform d) has a shorter and distinct C-terminus when it is compared to isoform a. This variant has also been called SpV-5 in PubMed ID: 18155631. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...