Diazepam Binding Inhibitor (DBI) (NM_001178017) Human Untagged Clone
CAT#: SC328232
DBI (untagged)-Human diazepam binding inhibitor (GABA receptor modulator acyl-CoA binding protein) (DBI) transcript variant 4
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACBD1; ACBP; CCK-RP; EP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001178017, the custom clone sequence may differ by one or more nucleotides
ATGGAGAGATGGGGGAAGGGGTTGCACGGATTGGAGGAGCGAGGAGACTCAGTCCCCATC CCGAAGCACAGGGCAGGACGTCGCGGCGGAGTGGGGAAGCGAGGAGTCCGTGGCCGAGAG CTTGGAGGTCAGGGGAAGTACGGGGCCGGCTGCTCAGAGTGCGGGACGAGGAGAATCGCG GCCCGGGGAGAGGCTGAGTTTGAGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAG CCATCGGATGAGGAGATGCTGTTCATCTATGGCCACTACAAACAAGCAACTGTGGGCGAC ATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAGGCCAAGTGGGATGCCTGG AATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACAAAGTAGAA GAGCTAAAGAAAAAATACGGGATATGA |
Restriction Sites | Please inquire |
ACCN | NM_001178017 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001178017.1, NP_001171488.1 |
RefSeq Size | 789 bp |
RefSeq ORF | 447 bp |
Locus ID | 1622 |
UniProt ID | P07108 |
Protein Families | Druggable Genome |
Protein Pathways | PPAR signaling pathway |
Gene Summary | This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, as compared to variant 5. The resulting isoform (4) has a longer and distinct N-terminus, compared to isoform 5. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229594 | DBI (Myc-DDK-tagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 4 |
CNY 3,990.00 |
|
RC229594L3 | Lenti-ORF clone of DBI (Myc-DDK-tagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 4 |
CNY 5,890.00 |
|
RC229594L4 | Lenti-ORF clone of DBI (mGFP-tagged)-Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 4 |
CNY 5,890.00 |
|
RG229594 | DBI (tGFP-tagged) - Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 4 |
CNY 4,370.00 |