Clathrin light chain (CLTA) (NM_001184762) Human Untagged Clone

CAT#: SC328260

CLTA (untagged)-Human clathrin light chain A (CLTA) transcript variant 6



  "NM_001184762" in other vectors (4)

CNY 3990.00


货期*
5周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CLTA mouse monoclonal antibody,clone OTI2D12
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LCA
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184762, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAGCTGGATCCGTTCGGCGCCCCTGCCGGCGCCCCTGGCGGTCCCGCGCTGGGG
AACGGAGTGGCCGGCGCCGGCGAAGAAGACCCGGCTGCGGCCTTCTTGGCGCAGCAAGAG
AGCGAGATTGCGGGCATCGAGAACGACGAGGCCTTCGCCATCCTGGACGGCGGCGCCCCC
GGGCCCCAGCCGCACGGCGAGCCGCCGGGGGGTCCGGATGCCAATTCTCGGAAGCAAGAA
GCAGAGTGGAAAGAAAAGGCAATAAAGGAGCTAGAAGAATGGTATGCAAGACAGGACGAG
CAGCTACAGAAAACAAAAGCAAACAACAGGGCAGCAGAAGAAGCCTTTGTAAATGACATT
GACGAGTCGTCCCCAGGCACTGAGTGGGAACGGGTGGCCCGGCTGTGTGACTTTAACCCC
AAGTCTAGCAAGCAGGCCAAAGATGTCTCCCGCATGCGCTCAGTCCTCATCTCCCTCAAG
CAGGCCCCGCTGGTGCACTGA
Restriction Sites Please inquire     
ACCN NM_001184762
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184762.1, NP_001171691.1
RefSeq Size 1000 bp
RefSeq ORF 501 bp
Locus ID 1211
UniProt ID P09496
Protein Pathways Endocytosis, Huntington's disease, Lysosome
Gene Summary Clathrin is a large, soluble protein composed of heavy and light chains. It functions as the main structural component of the lattice-type cytoplasmic face of coated pits and vesicles which entrap specific macromolecules during receptor-mediated endocytosis. This gene encodes one of two clathrin light chain proteins which are believed to function as regulatory elements. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 8 and 12. [provided by RefSeq, May 2010]
Transcript Variant: This variant (6) lacks four alternate in-frame exons, compared to variant 2, resulting in a shorter protein (isoform f), compared to isoform b.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...