CD8B (NM_001178100) Human Untagged Clone
CAT#: SC328312
CD8B (untagged)-Human CD8b molecule (CD8B) transcript variant 6
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD8B1; LEU2; LY3; LYT3; P37 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328312 representing NM_001178100.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCGGCCGCGGCTGTGGCTCCTCTTGGCCGCGCAGCTGACAGTTCTCCATGGCAACTCAGTCCTCCAG CAGACCCCTGCATACATAAAGGTGCAAACCAACAAGATGGTGATGCTGTCCTGCGAGGCTAAAATCTCC CTCAGTAACATGCGCATCTACTGGCTGAGACAGCGCCAGGCACCGAGCAGTGACAGTCACCACGAGTTC CTGGCCCTCTGGGATTCCGCAAAAGGGACTATCCACGGTGAAGAGGTGGAACAGGAGAAGATAGCTGTG TTTCGGGATGCAAGCCGGTTCATTCTCAATCTCACAAGCGTGAAGCCGGAAGACAGTGGCATCTACTTC TGCATGATCGTCGGGAGCCCCGAGCTGACCTTCGGGAAGGGAACTCAGCTGAGTGTGGTTGATTTCCTT CCCACCACTGCCCAGCCCACCAAGAAGTCCACCCTCAAGAAGAGAGTGTGCCGGTTACCCAGGCCAGAG ACCCAGAAGGGCCTCAAGGGGAAGGTATATCAGGAACCTTTGTCCCCCAATGCCTGCATGGATACTACA GCAATACTACAACCTCACAGAAGCTGCTTAACCCATGGATCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001178100 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001178100.1 |
RefSeq Size | 944 bp |
RefSeq ORF | 597 bp |
Locus ID | 926 |
UniProt ID | P10966 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
Protein Pathways | Antigen processing and presentation, Cell adhesion molecules (CAMs), Hematopoietic cell lineage, Primary immunodeficiency, T cell receptor signaling pathway |
MW | 22.2 kDa |
Gene Summary | The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified. [provided by RefSeq, May 2010] Transcript Variant: This variant (6) lacks two exons in the 3' coding region, which results in a frameshift, compared to variant 2. The resulting protein (isoform 6) is shorter and has a distinct C-terminus compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229674 | CD8B (Myc-DDK-tagged)-Human CD8b molecule (CD8B), transcript variant 6 |
CNY 2400.00 |
|
RC229674L1 | Lenti ORF clone of Human CD8b molecule (CD8B), transcript variant 6, Myc-DDK-tagged |
CNY 5890.00 |
|
RC229674L2 | Lenti ORF clone of Human CD8b molecule (CD8B), transcript variant 6, mGFP tagged |
CNY 4800.00 |
|
RC229674L3 | Lenti ORF clone of Human CD8b molecule (CD8B), transcript variant 6, Myc-DDK-tagged |
CNY 5890.00 |
|
RC229674L4 | Lenti ORF clone of Human CD8b molecule (CD8B), transcript variant 6, mGFP tagged |
CNY 5890.00 |
|
RG229674 | CD8B (tGFP-tagged) - Human CD8b molecule (CD8B), transcript variant 6 |
CNY 4370.00 |