Glycogenin 2 (GYG2) (NM_001184704) Human Untagged Clone
CAT#: SC328393
GYG2 (untagged)-Human glycogenin 2 (GYG2) transcript variant 5
CNY 3990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GN-2; GN2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001184704, the custom clone sequence may differ by one or more nucleotides
ATGGAACACGGCAGCTTTGACGGGGCAGACCAAGGCTTACTGAATAGTTTCTTCAGGAAC TGGTCGACCACAGACATCCACAAGCACCTGCCGTTCATCTATAACTTGAGTAGTAACACG ATGTACACTTACAGCCCTGCCTTCAAGCAATTCGGTTCCAGTGCAAAGGTCGTCCACTTT TTGGGGTCCATGAAACCTTGGAACTACAAGTACAATCCACAGAGTGGCTCGGTGTTGGAG CAAGGCTCAGCGTCCAGCAGCCAGCACCAGGCGGCATTCCTTCATCTCTGGTGGACGGTC TACCAGAACAACGTGCTGCCCCTTTATAAAAGCGTCCAAGCGGGGGAAGCACGCGCGTCT CCTGGTCACACACTTTGCCACAGTGATGTGGGGGGGCCGTGTGCGGATTCAGCCTCTGGT GTTGGAGAGCCGTGTGAAAATTCAACACCCAGTGCGGGCGTGCCGTGTGCAAATTCACCA CTGGGTTCTAACCAGCCTGCTCAGGGCCTTCCGGAGCCGACCCAGATAGTGGATGAGACC CTGTCCCTACCTGAAGGACGCCGTTCAGAAGATGTCGACCTGGCCGTCTCTGTTTCCCAG ATCTCCATCGAAGAGAAGGTGAAGGAATTGAGCCCCGAGGAAGAGAGGAGGAAGTGGGAG GAAGGCCGTATCGACTACATGGGGAAGGACGCGTTTGCTCGCATCCAGGAGAAGCTGGAC CGGTTCCTGCAGTAA |
Restriction Sites | Please inquire |
ACCN | NM_001184704 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001184704.1, NP_001171633.1 |
RefSeq Size | 2947 bp |
RefSeq ORF | 735 bp |
Locus ID | 8908 |
UniProt ID | O15488 |
Gene Summary | This gene encodes a member of the the glycogenin family. Glycogenin is a self-glucosylating protein involved in the initiation reactions of glycogen biosynthesis. A gene on chromosome 3 encodes the muscle glycogenin and this X-linked gene encodes the glycogenin mainly present in liver; both are involved in blood glucose homeostasis. This gene has a short version on chromosome Y, which is 3' truncated and can not make a functional protein. Multiple alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, May 2010] Transcript Variant: This variant (5) lacks two consecutive exons in the 5' CDS, resulting in a downstream in-frame AUG start codon, and also lacks two consecutive in-frame exons in the 3' CDS, as compared to variant 2. The resulting isoform (e) has a shorter N-terminus and lacks an internal segment in the C-terminal region, as compared to isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229755 | GYG2 (Myc-DDK-tagged)-Human glycogenin 2 (GYG2), transcript variant 5 |
CNY 3990.00 |
|
RC229755L3 | Lenti-ORF clone of GYG2 (Myc-DDK-tagged)-Human glycogenin 2 (GYG2), transcript variant 5 |
CNY 5890.00 |
|
RC229755L4 | Lenti-ORF clone of GYG2 (mGFP-tagged)-Human glycogenin 2 (GYG2), transcript variant 5 |
CNY 5890.00 |
|
RG229755 | GYG2 (tGFP-tagged) - Human glycogenin 2 (GYG2), transcript variant 5 |
CNY 4370.00 |
其它Glycogenin 2产品