HDAC8 (NM_001166418) Human Untagged Clone

CAT#: SC328469

HDAC8 (untagged)-Human histone deacetylase 8 (HDAC8) transcript variant 2



  "NM_001166418" in other vectors (6)

CNY 6270.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
HDAC8 mouse monoclonal antibody,clone OTI1A4
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDA07; CDLS5; HD8; HDACL1; KDAC8; MRXS6; RPD3; WTS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC328469 representing NM_001166418.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGAGCCGGAGGAACCGGCGGACAGTGGGCAGTCGCTGGTCCCGGTTTATATCTATAGTCCCGAG
TATGTCAGTATGTGTGACTCCCTGGCCAAGATCCCCAAACGGGCCAGTATGGTGCATTCTTTGATTGAA
GCATATGCACTGCATAAGCAGATGAGAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTG
GGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCACCATGGAGAT
GGTGTAGAAGACGCATTCAGTTTCACCTCCAAAGTCATGACCGTGTCCCTGCACAAATTCTCCCCAGGA
TTTTTCCCAGGAACAGGTGACGTGTCTGATGTTGGCCTAGGGAAGGGACGGTACTACAGTGTAAATGTG
CCCATTCAGGATGGCATACAAGATGAAAAATATTACCAGATCTGTGAAAGTGTACTAAAGGAAGTATAC
CAAGCCTTTAATCCCAAAGCAGTGGTCTTACAGCTGGGAGCTGACACAATAGCTGGGGATCCCATGTGC
TCCTTTAACATGACTCCAGTGGGAATTGGCAAGTGTCTTAAGTACATCCTTCAATGGCAGTTGGCAACA
CTCATTTTGGGAGGAGGAGGCTATAACCTTGCCAACACGGCTCGATGCTGGACATACTTGACCGGGGTC
ATCCTAGGGAAAACACTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATATGGTCCTGATTAT
GTGCTGGAAATCACGCCAAGCTGCCGGCCAGACCGCAATGAGCCCCACCGAATCCAACAAATCCTCAAC
TACATCAAAGGGAATCTGAAGCATGTGGTCTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001166418
Insert Size 861 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001166418.1
RefSeq Size 1791 bp
RefSeq ORF 861 bp
Locus ID 55869
UniProt ID Q9BY41
Protein Families Druggable Genome, Transcription Factors
MW 31.9 kDa
Gene Summary Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
Transcript Variant: This variant (2) lacks two alternate exons in the 5' coding region, compared to variant 1, resulting in a protein (isoform 2) that maintains the reading frame but is shorter, compared to isoform 1. Sequence Note: A downstream translational start codon is selected for this RefSeq based on a strong Kozak signal and transcript support. An upstream in-frame start codon is also present but has a weaker Kozak signal and sparse transcript support. Use of the upstream start codon would result in a protein that is 38 aa longer at the N-terminus. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon, which is supported by 5'RACE experiments described in PubMed: 10922473 and encodes a protein with an N-terminus similar to other family members.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...