Thrombopoietin (THPO) (NM_001177598) Human Untagged Clone
CAT#: SC328518
THPO (untagged)-Human thrombopoietin (THPO) transcript variant 3
CNY 6270.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MGDF; MKCSF; ML; MPLLG; THCYT1; TPO |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_001177598, the custom clone sequence may differ by one or more nucleotides
ATGGAGCTGACTGAATTGCTCCTCGTGGTCATGCTTCTCCTAACTGCAAGGCTAACGCTG TCCAGCCCGGCTCCTCCTGCTTGTGACCTCCGAGTCCTCAGTAAACTGCTTCGTGACTCC CATGTCCTTCACAGCAGACTGAGCCAGTGCCCAGAGGTTCACCCTTTGCCTACACCTGTC CTGCTGCCTGCTGTGGACTTTAGCTTGGGAGAATGGAAAACCCAGATGGAGGAGACCAAG GCACAGGACATTCTGGGAGCAGTGACCCTTCTGCTGGAGGGAGTGATGGCAGCACGGGGA CAACTGGGACCCACTTGCCTCTCATCCCTCCTGGGGCAGCTTTCTGGACAGGTCCGTCTC CTCCTTGGGGCCCTGCAGAGCCTCCTTGGAACCCAGGACCACAGCTCACAAGGATCCCAA TGCCATCTTCCTGAGCTTCCAACACCTGCTCCGAGGAAAGGTGCGTTTCCTGATGCTTGT AGGAGGGTCCACCCTCTGCGTCAGGCGGGCCCCACCCACCACAGCTGTCCCCAGCAGAAC CTCTCTAGTCCTCACACTGAACGAGCTCCCAAACAGGACTTCTGGATTGTTGGAGACAAA CTTCACTGCCTCAGCCAGAACTACTGGCTCTGGGCTTCTGAAGTGGCAGCAGGGATTCAG AGCCAAGATTCCTGGTCTGCTGAACCAAACCTCCAGGTCCCTGGACCAAATCCCCGGATA CCTGAACAGGATACACGAACTCTTGAATGGAACTCGTGGACTCTTTCCTGGACCCTCACG CAGGACCCTAGGAGCCCCGGACATTTCCTCAGGAACATCAGACACAGGCTCCCTGCCACC CAACCTCCAGCCTGGATATTCTCCTTCCCCAACCCATCCTCCTACTGGACAGTATACGCT CTTCCCTCTTCCACCCACCTTGCCCACCCCTGTGGTCCAGCTCCACCCCCTGCTTCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001177598 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001177598.1, NP_001171069.1 |
RefSeq Size | 1788 bp |
RefSeq ORF | 960 bp |
Locus ID | 7066 |
UniProt ID | P40225 |
Protein Families | Druggable Genome, Secreted Protein |
Protein Pathways | Hematopoietic cell lineage |
Gene Summary | Megakaryocytopoiesis is the cellular development process that leads to platelet production. The main functional protein encoded by this gene is a humoral growth factor that is necessary for megakaryocyte proliferation and maturation, as well as for thrombopoiesis. This protein is the ligand for MLP/C_MPL, the product of myeloproliferative leukemia virus oncogene. Mutations in this gene are the cause of thrombocythemia 1. Alternative promoter usage and differential splicing result in multiple transcript variants differing in the 5' UTR and/or coding region. Multiple AUG codons upstream of the main open reading frame (ORF) have been identified, and these upstream AUGs inhibit translation of the main ORF at different extent. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (3) represents use of the downstream promoter and comprises six exons. It uses an alternate splice site in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (3) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229880 | THPO (Myc-DDK-tagged)-Human thrombopoietin (THPO), transcript variant 3 |
CNY 3990.00 |
|
RC229880L3 | Lenti-ORF clone of THPO (Myc-DDK-tagged)-Human thrombopoietin (THPO), transcript variant 3 |
CNY 5890.00 |
|
RC229880L4 | Lenti-ORF clone of THPO (mGFP-tagged)-Human thrombopoietin (THPO), transcript variant 3 |
CNY 5890.00 |
|
RG229880 | THPO (tGFP-tagged) - Human thrombopoietin (THPO), transcript variant 3 |
CNY 4370.00 |
其它Thrombopoietin产品