Somatostatin Receptor 5 (SSTR5) (NM_001172560) Human Untagged Clone
CAT#: SC328586
SSTR5 (untagged)-Human somatostatin receptor 5 (SSTR5) transcript variant 2
CNY 5,488.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SS-5-R |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC328586 representing NM_001172560
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCCCTGTTCCCAGCCTCCACGCCCAGCTGGAACGCCTCCTCCCCGGGGGCTGCCTCTGGAGGCG GTGACAACAGGACGCTGGTGGGGCCGGCGCCCTCGGCAGGGGCCCGGGCGGTGCTGGTGCCCGTGCTGTA CCTGCTGGTGTGTGCGGCCGGGCTGGGCGGGAACACGCTGGTCATCTACGTGGTGCTGCGCTTCGCCAAG ATGAAGACCGTCACCAACATCTACATTCTCAACCTGGCAGTGGCCGACGTCCTGTACATGCTGGGGCTGC CTTTCCTGGCCACGCAGAACGCCGCGTCCTTCTGGCCCTTCGGCCCCGTCCTGTGCCGCCTGGTCATGAC GCTGGACGGCGTCAACCAGTTCACCAGTGTCTTCTGCCTGACAGTCATGAGCGTGGACCGCTACCTGGCA GTGGTGCACCCGCTGAGCTCGGCCCGCTGGCGCCGCCCGCGTGTGGCCAAGCTGGCGAGCGCCGCGGCCT GGGTCCTGTCTCTGTGCATGTCGCTGCCGCTCCTGGTGTTCGCGGACGTGCAGGAGGGCGGTACCTGCAA CGCCAGCTGGCCGGAGCCCGTGGGGCTGTGGGGCGCCGTCTTCATCATCTACACGGCCGTGCTGGGCTTC TTCGCGCCGCTGCTGGTCATCTGCCTGTGCTACCTGCTCATCGTGGTGAAGGTGAGGGCGGCGGGCGTGC GCGTGGGCTGCGTGCGGCGGCGCTCGGAGCGGAAGGTGACGCGCATGGTGTTGGTGGTGGTGCTGGTGTT TGCGGGATGTTGGCTGCCCTTCTTCACCGTCAACATCGTCAACCTGGCCGTGGCGCTGCCCCAGGAGCCC GCCTCCGCCGGCCTCTACTTCTTCGTGGTCATCCTCTCCTACGCCAACAGCTGTGCCAACCCCGTCCTCT ACGGCTTCCTCTCTGACAACTTCCGCCAGAGCTTCCAGAAGGTTCTGTGCCTCCGCAAGGGCTCTGGTGC CAAGGACGCTGACGCCACGGAGCCGCGTCCAGACAGGATCCGGCAGCAGCAGGAGGCCACGCCACCCGCG CACCGCGCCGCAGCCAACGGGCTTATGCAGACCAGCAAGCTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001172560 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001172560.1, NP_001166031.1 |
RefSeq Size | 2657 bp |
RefSeq ORF | 1095 bp |
Locus ID | 6755 |
UniProt ID | P35346 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) has an alternate 5' UTR, as compared to variant 1. Both variants 1 and 2 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC229948 | SSTR5 (Myc-DDK-tagged)-Human somatostatin receptor 5 (SSTR5), transcript variant 2 |
CNY 5,488.00 |
|
RC229948L3 | Lenti-ORF clone of SSTR5 (Myc-DDK-tagged)-Human somatostatin receptor 5 (SSTR5), transcript variant 2 |
CNY 5,890.00 |
|
RC229948L4 | Lenti-ORF clone of SSTR5 (mGFP-tagged)-Human somatostatin receptor 5 (SSTR5), transcript variant 2 |
CNY 5,890.00 |
|
RG229948 | SSTR5 (tGFP-tagged) - Human somatostatin receptor 5 (SSTR5), transcript variant 2 |
CNY 4,370.00 |
其它Somatostatin Receptor 5产品