NSMCE4A (NM_001167865) Human Untagged Clone

CAT#: SC328608

NSMCE4A (untagged)-Human non-SMC element 4 homolog A (S. cerevisiae) (NSMCE4A) transcript variant 2



  "NM_001167865" in other vectors (4)

CNY 7220.00


货期*
6周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-NSMCE4A Antibody
    • 100 ul

CNY 5250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C10orf86; NS4EA; NSE4A
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001167865, the custom clone sequence may differ by one or more nucleotides
ATGTCTGGGGACAGCAGCGGCCGCGGGCCAGAGGGCCGGGGCCGGGGCCGCGACCCGCAT
CGGGATCGCACCCGCTCCCGCTCCCGCTCGCGGTCCCCTTTGTCGCCCAGGTCCCGCCGC
GGCTCTGCGCGGGAGCGCAGAGAGGCCCCAGAGCGCCCGAGCCTGGAGGACACAGAGCCG
TCGGATTCCGGGGACGAGATGATGGACCCGGCCAGCTTGGAGGCGGAGGCCGACCAAGGC
CTGTGCCGCCAGATCCGCCATCAGTACCGGGCGCTCATCAACTCCGTCCAACAAAACCGT
GAGGACATACTGAATGCCGGTGACAAATTAACAGAGGTCCTTGAAGAGGCTAACACTCTG
TTTAATGAAGTGTCCCGAGCAAGAGAAGCAGTCCTGGATGCCCACTTTCTTGTTTTGGCT
TCAGATTTGGGCAAAGAGAAAGCAAAGCAGCTGCGCTCAGACCTGAGCTCCTTTGACATG
TTAAGATATGTTGAAACTCTACTCACACATATGGGTGTAAATCCGCTAGAAGCTGAAGAA
CTCATCCGTGATGAAGATAGTCCTGATTTTGAATTCATAGTCTATGACTCCTGGAAGATA
ACAGGCAGAACAGCAGAAAACACCTTTAATAAAACCCATACATTCCACTTTCTGTTGGGT
TCAATATACGGAGAGTGCCCTGTGCCAAAGCCACGAGTTGATCGTCCAAGAAAAGTTCCT
GTGATACAAGAGGAGAGGGCAATGCCTGCCCAGTTAAGAAGAATGGAAGAATCTCATCAA
GAAGCAACAGAGAAAGAAGTAGAAAGAATCTTGGGATTGTTGCAGACATATTTTCGAGAA
GATCCTGATACCCCAATGTCCTTCTTTGACTTTGTGGTTGATCCTCATTCTTTCCCCCGT
ACAGTGGAAAACATCTTTCATGTTTCCTTCATTATACGGGATGGTTTTGCAAGAATAAGA
CTTGACCAAGACCGACTGCCAGTAATAGAGCCTGTTAGTATTAATGAAGAAAATGAGGGA
TTTGAACATAACACACAAGTTAGAAATCAAGGAATTATAGCTTTGAGTTACCGTGACTGG
GAGATTGTGAAGACCTTTGAGATTTCAGAGCCTGTGATTACTCCAAGTCAGAGGCAGCAG
AAGCCAAGTGCTTGA
Restriction Sites Please inquire     
ACCN NM_001167865
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001167865.1, NP_001161337.1
RefSeq Size 1417 bp
RefSeq ORF 1155 bp
Locus ID 54780
UniProt ID Q9NXX6
Gene Summary Component of the SMC5-SMC6 complex, a complex involved in DNA double-strand breaks by homologous recombination. The complex may promote sister chromatid homologous recombination by recruiting the SMC1-SMC3 cohesin complex to double-strand breaks. The complex is required for telomere maintenance via recombination in ALT (alternative lengthening of telomeres) cell lines and mediates sumoylation of shelterin complex (telosome) components which is proposed to lead to shelterin complex disassembly in ALT-associated PML bodies (APBs). Is involved in positive regulation of response to DNA damage stimulus.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...