MEPE (NM_001184697) Human Untagged Clone

CAT#: SC328671

MEPE (untagged)-Human matrix extracellular phosphoglycoprotein (MEPE) transcript variant 5



  "NM_001184697" in other vectors (4)

CNY 7220.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MEPE Antibody
    • 100 ul

CNY 5250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms OF45
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001184697, the custom clone sequence may differ by one or more nucleotides
ATGTCAATTTATCCTAAGTCAACTGGGAATAAAGGGTTTGAGGATGGAGATGATGCTATC
AGCAAACTACATGACCAAGAAGAATATGGCGCAGCTCTCATCAGAAATAACATGCAACAT
ATAATGGGGCCAGTGACTGCGATTAAACTCCTGGGGGAAGAAAACAAAGAGAACACACCT
AGGAATGTTCTAAACATAATCCCAGCAAGTATGAATTATGCTAAAGCACACTCGAAGGAT
AAAAAGAAGCCTCAAAGAGATTCCCAAGCCCAGAAAAGTCCAGTAAAAAGCAAAAGCACC
CATCGTATTCAACACAACATTGACTACCTAAAACATCTCTCAAAAGTCAAAAAAATCCCC
AGTGATTTTGAAGGCAGCGGTTATACAGATCTTCAAGAGAGAGGGGACAATGATATATCT
CCTTTCAGTGGGGACGGCCAACCTTTTAAGGACATTCCTGGTAAAGGAGAAGCTACTGGT
CCTGACCTAGAAGGCAAAGATATTCAAACAGGGTTTGCAGGCCCAAGTGAAGCTGAGAGT
ACTCATCTTGACACAAAAAAGCCAGGTTATAATGAGATCCCAGAGAGAGAAGAAAATGGT
GGAAATACCATTGGAACTAGGGATGAAACTGCGAAAGAGGCAGATGCTGTTGATGTCAGC
CTTGTAGAGGGCAGCAACGATATCATGGGTAGTACCAATTTTAAGGAGCTCCCTGGAAGA
GAAGGAAACAGAGTGGATGCTGGCAGCCAAAATGCTCACCAAGGGAAGGTTGAGTTTCAT
TACCCTCCTGCACCCTCAAAAGAGAAAAGAAAAGAAGGCAGTAGTGATGCAGCTGAAAGT
ACCAACTATAATGAAATTCCTAAAAATGGCAAAGGCAGTACCAGAAAGGGTGTAGATCAT
TCTAATAGGAACCAAGCAACCTTAAATGAAAAACAAAGGTTTCCTAGTAAGGGCAAAAGT
CAGGGCCTGCCCATTCCTTCTCGTGGTCTTGATAATGAAATCAAAAACGAAATGGATTCC
TTTAATGGCCCCAGTCATGAGAATATAATAACACATGGCAGAAAATATCATTATGTACCC
CACAGACAAAATAATTCTACACGGAATAAGGGTATGCCACAAGGGAAAGGCTCCTGGGGT
AGACAACCCCATTCCAACAGGAGGTTTAGTTCCCGTAGAAGGGATGACAGTAGTGAGTCA
TCTGACAGTGGCAGTTCAAGTGAGAGCGATGGTGACTAG
Restriction Sites Please inquire     
ACCN NM_001184697
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001184697.1, NP_001171626.1
RefSeq Size 2206 bp
RefSeq ORF 1239 bp
Locus ID 56955
UniProt ID Q9NQ76
Protein Families Secreted Protein
Gene Summary This gene encodes a secreted calcium-binding phosphoprotein that belongs to the small integrin-binding ligand, N-linked glycoprotein (SIBLING) family of proteins. Members of this family are components of the extracellular matrix of bone and dentin and regulate bone mineralization. Deficiency of a similar protein in mouse results in increased bone mass. Mice lacking this gene are resistant to aging-related trabecular bone loss. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (5) contains an alternate exon resulting in the use of a downstream start codon compared to variant 6. The encoded isoform (b) has a shorter N-terminus compared to isoform c. Variants 3, 4, and 5 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...