AK2 (NM_001199199) Human Untagged Clone

CAT#: SC329496

AK2 (untagged) - Homo sapiens adenylate kinase 2 (AK2), transcript variant 3



  "NM_001199199" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-AK2 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ADK2
Vector pCMV6-Entry
Sequence Data
>SC329496 representing NM_001199199.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTATCCTAAAGGCATCCGGGCCGTGCTGCTGGGGCCT
CCCGGGGCCGGTAAAGGGACCCAGGCACCCAGATTGGCTGAAAACTTCTGTGTCTGCCATTTAGCTACT
GGGGACATGCTGAGGGCCATGGTGGCTTCTGGCTCAGAGCTAGGAAAAAAGCTGAAGGCAACTATGGAT
GCTGGGAAACTGGTGAGTGATGAAATGGTAGTGGAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTGC
AAAAATGGTTTTCTTCTGGATGGCTTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGATGACCTCATG
GAGAAGAGGAAAGAGAAGCTTGATTCTGTGATTGAATTCAGCATCCCAGACTCTCTGCTGATTCACCCC
AAGAGTGGCCGTTCCTACCACGAGGAGTTCAACCCTCCAAAAGAGCCCATGAAAGATGACATCACCGGG
GAACCCTTGATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACACT
CAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCATCGATGCATCCCAGACC
CCCGATGTCGTGTTCGCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATCCTAG

Restriction Sites SgfI-MluI     
ACCN NM_001199199
Insert Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199199.1
RefSeq Size 3647 bp
RefSeq ORF 675 bp
Locus ID 204
UniProt ID P54819
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Purine metabolism
MW 24.6 kDa
Gene Summary Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010]
Transcript Variant: This variant (3) uses an alternate in-frame splice junction and differs in the 3' UTR and coding sequence compared to variant 1. The resulting isoform (c) lacks an alternate internal segment and has a shorter and distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...