SH3 containing Grb 2 like 1 protein (SH3GL1) (NM_001199944) Human Untagged Clone

CAT#: SC329598

SH3GL1 (untagged) - Homo sapiens SH3-domain GRB2-like 1 (SH3GL1), transcript variant 3



  "NM_001199944" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
SH3GL1 mouse monoclonal antibody, clone OTI2F5 (formerly 2F5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CNSA1; EEN; SH3D2B; SH3P8
Vector pCMV6-Entry
Sequence Data
>SC329598 representing NM_001199944.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGTCGGTGGCGGGGCTGAAGAAGCAGTTCTACAAGGCGAGCCAGCTGGTCAGTGAGAAGGTCGGAGGG
GCCGAGGGGACCAAGCTGGATGATGACTTCAAAGAGATGGAGAAGAAGGTGGATGTCACCAGCAAGGCG
GTGACAGAAGTGCTGGCCAGGACCATCGAGTACCTGCAGCCCAACCCAGCCTCGCGGGCTAAGCTGACC
ATGCTCAACACGGTGTCCAAGATCCGGGGCCAGAACCTGTGCGAGAAAGACCTGAAGGAGATCCAGCAC
CACCTGAAGAAACTGGAGGGCCGCCGCCTGGACTTTGACTACAAGAAGAAGCGGCAGGGCAAGATCCCC
GATGAGGAGCTACGCCAGGCGCTGGAGAAGTTCGAGGAGTCCAAGGAGGTGGCAGAAACCAGCATGCAC
AACCTCCTGGAGACTGACATCGAGCAGGTGAGTCAGCTCTCGGCCCTGGTGGATGCACAGCTGGACTAC
CACCGGCAGGCCGTGCAGATCCTGGACGAGCTGGCGGAGAAGCTCAAGCGCAGGATGCGGGAAGCTTCC
TCACGCCCTAAGCGGGAGTATAAGCCCAAGCCCCGGGAGCCCTTTGACCTTGGAGAGCCTGAGCAGTCC
AACGGGGGCTTCCCCTGCACCACAGCCCCCAAGATCGCAGCTTCATCGTCTTTCCGATCTTCCGACAAG
CCCATCCGGACCCCTAGCCGGAGCATGCCGCCCCTGGACCAGCCGAGCTGCAAGGCGCTGTACGACTTC
GAGCCCGAGAACGACGGGGAGCTGGGCTTCCATGAGGGCGACGTCATCACGCTGACCAACCAGATCGAT
GAGAACTGGTACGAGGGCATGCTGGACGGCCAGTCGGGCTTCTTCCCGCTCAGCTACGTGGAGGTGCTT
GTGCCCCTGCCGCAGTGA

Restriction Sites SgfI-MluI     
ACCN NM_001199944
Insert Size 915 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001199944.1
RefSeq Size 2217 bp
RefSeq ORF 915 bp
Locus ID 6455
UniProt ID Q99961
Protein Families Druggable Genome
Protein Pathways Endocytosis
MW 34.5 kDa
Gene Summary This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (3) uses two alternate in-frame splice sites in the coding region but maintains the reading frame, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它SH3 containing Grb 2 like 1 protein产品

Customer Reviews 
Loading...