NDUFB5 (NM_001199958) Human Untagged Clone
CAT#: SC329602
NDUFB5 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), transcript variant 3
CNY 2950.00
Product images

CNY 6281.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CISGDH; SGDH |
Vector | pCMV6-Entry |
Sequence Data |
>SC329602 representing NM_001199958.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGCGGCCATGAGTTTGTTGCGGCGGGTTTCGGTTACTGCGGTGGCAGCTCTGTCTGGCCGGCCCCTT GGCACTCGCCTCGGATTTGGGGGCTTCCTCACTCGTGGCTTTCCGAAGGCTGCTGCTCCTGTTCGACAC AGTGGAGACCATGGGAAAAGACTATTTGTCATCAGACCTTCTAGATTCTATGACAGGCGTTTTTTGAAG TTATTGAGATTCTACATTGCATTGACTGGGATTCCAGTAGCAATTTTCATAACTCTGGTGAATGTATTC ATTGGTCAAGCTGAACTAGCAGAAATTCCAGAAGGCTATGTCCCAGAACACTGGGAATATTATAAGGGT AAAGGAGCTGGAAGTGCGAAAATTGATGCATGTGAGAGGAGATGGACCCTGGTATTACTATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001199958 |
Insert Size | 408 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001199958.1 |
RefSeq Size | 969 bp |
RefSeq ORF | 408 bp |
Locus ID | 4711 |
UniProt ID | O43674 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 15 kDa |
Gene Summary | The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. It locates at the mitochondrial inner membrane. This protein has NADH dehydrogenase activity and oxidoreductase activity. It transfers electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (3) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231772 | NDUFB5 (Myc-DDK tagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), transcript variant 3 |
CNY 3990.00 |
|
RG231772 | NDUFB5 (tGFP-tagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 5, 16kDa (NDUFB5), transcript variant 3 |
CNY 4370.00 |