HYAL3 (NM_001200030) Human Untagged Clone

CAT#: SC329610

HYAL3 (untagged) - Homo sapiens hyaluronoglucosaminidase 3 (HYAL3), transcript variant 2



  "NM_001200030" in other vectors (2)

CNY 3710.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-HYAL3 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HYAL-3; LUCA-3; LUCA3
Vector pCMV6-Entry
Sequence Data
>SC329610 representing NM_001200030.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACCACGCAACTGGGCCCAGCCCTGGTGCTGGGGGTGGCCCTGTGCCTGGGTTGTGGCCAGCCCCTA
CCACAGGTCCCTGAACGCCCCTTCTCTGTGCTGTGGAATGTACCCTCAGCACACTGTGAGGCCCGCTTT
GGTGTGCACCTGCCACTCAATGCTCTGGGCATCATAGCCAACCGTGGCCAGCATTTTCACGGTCAGAAC
ATGACCATTTTCTACAAGAACCAACTCGGCCTCTATCCCTACTTTGGACCCAGGGGCACAGCTCACAAT
GGGGGCATCCCCCAGGCTTTGCCCCTTGACCGCCACCTGGCACTGGCTGCCTACCAGATCCACCACAGC
CTGAGACCTGGCTTTGCTGGCCCAGCAGTGCTGGATTGGGAGGAGTGGTGTCCACTCTGGGCTGGGAAC
TGGGGCCGCCGCCGAGCTTATCAGGCAGCCTCTTGGGCTTGGGCACAGCAGGTATTCCCTGACCTGGAC
CCTCAGGAGCAGCTCTACAAGGCCTATACTGGCTTTGAGCAGGCGGCCCGTGCACTGATGGAGGATACG
CTGCGGGTGGCCCAGGCACTACGGCCCCATGGACTCTGGGGCTTCTATCACTACCCAGCCTGTGGCAAT
GGCTGGCATAGTATGGCTTCCAACTATACCGGCCGCTGCCATGCAGCCACCCTTGCCCGCAACACTCAA
CTGCATTGGCTCTGGGCCGCCTCCAGTGCCCTCTTCCCCAGCATCTACCTCCCACCCAGGCTGCCACCT
GCCCACCACCAGGCCTTTGTCCGACATCGCCTGGAGGAGGCCTTCCGTGTGGCCCTTGTTGGGCACCGA
CATCCCCTGCCTGTCCTGGCCTATGTCCGCCTCACACACCGGAGATCTGGGAGGTTCCTGTCCCAGGAG
GAGTGCTGGCATCTCCATGACTACCTGGTGGACACCTTGGGCCCCTATGTGATCAATGTGACCAGGGCA
GCGATGGCCTGCAGTCACCAGCGGTGCCATGGCCACGGGCGCTGTGCCCGGCGAGATCCAGGACAGATG
GAAGCCTTTCTACACCTGTGGCCAGACGGCAGCCTTGGAGATTGGAAGTCCTTCAGCTGCCACTGTTAC
TGGGGCTGGGCTGGCCCCACCTGCCAGGAGCCCAGGCCTGGGCCTAAAGAAGCAGTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001200030
Insert Size 1164 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001200030.1
RefSeq Size 1855 bp
RefSeq ORF 1164 bp
Locus ID 8372
UniProt ID O43820
Protein Families Secreted Protein
Protein Pathways Glycosaminoglycan degradation, Metabolic pathways
MW 43.6 kDa
Gene Summary This gene encodes a member of the hyaluronidase family. Hyaluronidases are endoglycosidase enzymes that degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. The regulated turnover of hyaluronan plays a critical role in many biological processes including cell proliferation, migration and differentiation. The encoded protein may also play an important role in sperm function. This gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression, and the expression of specific transcript variants may be indicative of tumor status. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and some isoforms may lack hyaluronidase activity. This gene overlaps and is on the same strand as N-acetyltransferase 6 (GCN5-related), and some transcripts of each gene share a portion of the first exon. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2), also known as HYAL3-v1, lacks an exon in the coding region but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...