SEM1 (NM_001201450) Human Untagged Clone

Specifications

Product Data
Type	Human Untagged Clone
Tag	Tag Free
Synonyms	C7orf76; DSS1; ECD; SHFD1; Shfdg1; SHFM1; SHSF1
Vector	pCMV6-Entry
Sequence Data	Fully Sequenced ORF (showhide) >SC329621 representing NM_001201450. Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGTATTGCCAGGACTCCAACATTTGTGCTGTGTTTGCTGTACAAGGAGGAAAAGTGGGAAGAAAGCAT GGCATAAAAAGGGGGAGGAGACCCAGCATAAGAAGCCCAGCTCAGCGGGCCAGAGGACCCTGGATCCAT GAGAGTAAGCATCCGGCCTTTGCAAAGCAACAGATAAACTTGGAGATGCCCAACTCCAGAGCGACAACA GAGTTAGCCTGGGTCTGCAGCTCCACCTCAAGAAAAAAGAAGTGGGCAAGGTCCCTGACTCTTTCCACT GCTCCACTGAGCCCCCCACCATCCTTGGTGCACTGTGAAGATTGTTCTTGCCTGCCTGGCTGCCATTCG GGTGACCTCTACAATCTGGCCCCAGCAGAAAGAACTTGCTAG
Restriction Sites	SgfI-MluI
ACCN	NM_001201450
Insert Size	387 bp
OTI Disclaimer	Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components	The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution	1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq	NM_001201450.1
RefSeq Size	2707 bp
RefSeq ORF	387 bp
Locus ID	7979
Protein Pathways	Homologous recombination, Proteasome
MW	14.1 kDa
Gene Summary	The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (6) represents the use of an alternate promoter, resulting in a different 5' UTR and use of an alternate start codon, compared to variant 1. It encodes isoform 4, which is longer and has a distinct N-terminus, compared to isoform 1.

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.