ALDH7A1 (NM_001202404) Human Untagged Clone

CAT#: SC329643

ALDH7A1 (untagged) - Homo sapiens aldehyde dehydrogenase 7 family, member A1 (ALDH7A1), transcript variant 2



  "NM_001202404" in other vectors (2)

CNY 4750.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ALDH7A1 mouse monoclonal antibody,clone OTI1A9
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ATQ1; EPD; PDE
Vector pCMV6-Entry
Sequence Data
>SC329643 representing NM_001202404.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGGTTCTCCCGGGCGGGGGGCGGGGCTCTATTTCAGCAGCTCTCAGGGCCTTGGGCTCATCCCGAGT
CCCGGGCTCAGTATGTGGCGCCTTCCTCGCGCGCTGTGTGTGCACGCTGCAAAGACCAGCAAGCTCTCT
GGACCTTGGAGCAGGCCTGCCGCCTTCATGTCCACTCTCCTCATCAATCAGCCCCAGTATGCGTGGCTG
AAAGAGCTGGGGCTCCGCGAGGAAAACGAGGGCGTGTATAATGGAAGCTGGGGAGGCCGGGGAGAGGTT
ATTACGACCTATTGCCCTGCTAACAACGAGCCAATAGCAAGAGTCCGACAGGCCAGTGTGGCAGACTAT
GAAGAAACTGTAAAGAAAGCAAGAGAAGCATGGAAAATCTGGGCAGATATTCCTGCTCCAAAACGAGGA
GAAATAGTAAGACAGATTGGCGATGCCTTGCGGGAGAAGATCCAAGTACTAGGAAGCTTGGTGTCTTTG
GAGATGGGGAAAATCTTAGTGGAAGGTGTGGGTGAAGTTCAGGAGTATGTGGATATCTGTGACTATGCT
GTTGGTTTATCAAGGATGATTGGAGGACCTATCTTGCCTTCTGAAAGATCTGGCCATGCACTGATTGAG
CAGTGGAATCCCGTAGGCCTGGTTGGAATCATCACGGCATTCAATTTCCCTGTGGCAGTGTATGGTTGG
AACAACGCCATCGCCATGATCTGTGGAAATGTCTGCCTCTGGAAAGGAGCTCCAACCACTTCCCTCATT
AGTGTGGCTGTCACAAAGATAATAGCCAAGGTTCTGGAGGACAACAAGCTGCCTGGTGCAATTTGTTCC
TTGACTTGTGGTGGAGCAGATATTGGCACAGCAATGGCCAAAGATGAACGAGTGAACCTGCTGTCCTTC
ACTGGGAGCACTCAGGTGGGAAAACAGGTGGGCCTGATGGTGCAGGAGAGGTTTGGGAGAAGTCTGTTG
GAACTTGGAGGAAACAATGCCATTATTGCCTTTGAAGATGCAGACCTCAGCTTAGTTGTTCCATCAGCT
CTCTTCGCTGCTGTGGGAACAGCTGGCCAGAGGTGTACCACTGCGAGGCGACTGGTTATGGATCGCCCT
GGAAATTATGTAGAACCGACAATTGTGACAGGTCTTGGCCACGATGCGTCCATTGCACACACAGAGACT
TTTGCTCCGATTCTCTATGTCTTTAAATTCAAGAATGAAGAAGAGGTCTTTGCATGGAATAATGAAGTA
AAACAGGGACTTTCAAGTAGCATCTTTACCAAAGATCTGGGCAGAATCTTTCGCTGGCTTGGACCTAAA
GGATCAGACTGTGGCATTGTAAATGTCAACATTCCAACAAGTGGGGCTGAGATTGGAGGTGCCTTTGGA
GGAGAAAAGCACACTGGTGGTGGCAGGGAGTCTGGCAGTGATGCCTGGAAACAGTACATGAGAAGGTCT
ACTTGTACTATCAACTACAGTAAAGACCTTCCTCTGGCCCAAGGAATCAAGTTTCAGTAA

Restriction Sites SgfI-MluI     
ACCN NM_001202404
Insert Size 1509 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001202404.1
RefSeq Size 4761 bp
RefSeq ORF 1509 bp
Locus ID 501
UniProt ID P49419
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Ascorbate and aldarate metabolism, beta-Alanine metabolism, Butanoate metabolism, Fatty acid metabolism, Glycerolipid metabolism, Glycolysis / Gluconeogenesis, Histidine metabolism, Limonene and pinene degradation, Lysine degradation, Metabolic pathways, Propanoate metabolism, Pyruvate metabolism, Tryptophan metabolism, Valine, leucine and isoleucine degradation
MW 54 kDa
Gene Summary The protein encoded by this gene is a member of subfamily 7 in the aldehyde dehydrogenase gene family. These enzymes are thought to play a major role in the detoxification of aldehydes generated by alcohol metabolism and lipid peroxidation. This particular member has homology to a previously described protein from the green garden pea, the 26g pea turgor protein. It is also involved in lysine catabolism that is known to occur in the mitochondrial matrix. Recent reports show that this protein is found both in the cytosol and the mitochondria, and the two forms likely arise from the use of alternative translation initiation sites. An additional variant encoding a different isoform has also been found for this gene. Mutations in this gene are associated with pyridoxine-dependent epilepsy. Several related pseudogenes have also been identified. [provided by RefSeq, Jan 2011]
Transcript Variant: This variant (2) is missing two in-frame coding exons compared to variant 1, resulting in a shorter isoform (3) lacking an internal protein segment compared to isoform 1. Sequence Note: This Refseq, containing three potential in-frame translation initiation codons (all with weak Kozak signals), is annotated with a CDS starting from a downstream start codon (at nt 193-195) based on better conservation, N-terminal consistency with homologous proteins, and the presence of a transit peptide, which is essential for the localization of this isoform in the mitochondria (PMIDs: 20207735 and 19885858), and is consistent with the function of this gene in lysine catabolism (which is known to occur in the mitochondria). The use of an upstream start codon (at nt 112-114) that is present in only a subset of higher mammals, would increase the protein length by 27 aa. This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus based on the use of a downstream in-frame start codon, which is more supported by the available transcript and conservation data. There is a higher probability of an N-terminal transit peptide being present in the updated protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...