UBE2G2 (NM_001202489) Human Untagged Clone
CAT#: SC329664
UBE2G2 (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2G 2 (UBE2G2), transcript variant 3
CNY 2950.00
货期*
4周
规格
Product images

推荐一起购买 (4)
UBE2G2 mouse monoclonal antibody, clone OTI1B10 (formerly 1B10)
CNY 1999.00
CNY 2700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | UBC7 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329664 representing NM_001202489.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGAGATTTACCTGTGAGATGTTTCATCCCAACATCTACCCTGATGGGAGAGTCTGCATTTCCATCCTC CACGCGCCAGGCGATGACCCCATGGGCTACGAGAGCAGCGCGGAGCGGTGGAGTCCTGTGCAGAGTGTG GAGAAGATCCTGCTGTCGGTGGTGAGCATGCTGGCAGAGCCCAATGACGAAAGTGGAGCTAACGTGGAT GCGTCCAAAATGTGGCGCGATGACCGGGAGCAGTTCTATAAGATTGCCAAGCAGATCGTCCAGAAGTCT CTGGGACTGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001202489 |
Insert Size | 288 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001202489.1 |
RefSeq Size | 3318 bp |
RefSeq ORF | 288 bp |
Locus ID | 7327 |
UniProt ID | P60604 |
Protein Families | Druggable Genome |
Protein Pathways | Parkinson's disease, Ubiquitin mediated proteolysis |
MW | 10.8 kDa |
Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein shares 100% sequence identity with the mouse counterpart. This gene is ubiquitously expressed, with high expression seen in adult muscle. Three alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (3) lacks an exon in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (3) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...