UBE2H (NM_001202498) Human Untagged Clone

CAT#: SC329665

UBE2H (untagged) - Homo sapiens ubiquitin-conjugating enzyme E2H (UBE2H), transcript variant 3



  "NM_001202498" in other vectors (2)

CNY 2,950.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
UBE2H Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E2-20K; GID3; UBC8; UBCH; UBCH2
Vector pCMV6-Entry
Sequence Data
>SC329665 representing NM_001202498.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAATAAAATTTTCCATCCCAACATTGATGAAGCGTCAGGAACTGTGTGTCTAGATGTAATTAATCAA
ACTTGGACAGCTCTCTATGATCTTACCAATATATTTGAGTCCTTCCTGCCTCAGTTATTGGCCTATCCT
AACCCCATAGATCCTCTCAATGGTGACGCTGCAGCCATGTACCTCCACCGACCAGAAGAATACAAGCAG
AAAATTAAAGAGTACATCCAGAAATACGCCACGGAGGAGGCGCTGAAAGAACAGGAAGAGGGTACCGGG
GACAGCTCATCGGAGAGCTCTATGTCTGACTTTTCCGAAGATGAGGCCCAGGATATGGAGTTGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001202498
Insert Size 342 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001202498.1
RefSeq Size 4778 bp
RefSeq ORF 342 bp
Locus ID 7328
UniProt ID P62256
Protein Pathways Ubiquitin mediated proteolysis
MW 12.9 kDa
Gene Summary The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. The encoded protein sequence is 100% identical to the mouse homolog and 98% identical to the frog and zebrafish homologs. Three alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (3) has an alternate splice site in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (3) has a shorter N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...