NDUFC2 (NM_001204054) Human Untagged Clone
CAT#: SC329687
NDUFC2 (untagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa (NDUFC2), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | B14.5b; CI-B14.5b; HLC-1; NADHDH2 |
Vector | pCMV6-Entry |
Sequence Data |
>SC329687 representing NM_001204054.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGATCGCACGGCGGAACCCAGAACCCTTACGGTTTCTGCCGGATGAGGCCCGGAGCCTGCCCCCGCCC AAGCTGACCGACCCGCGGCTCCTCTACATCGGCTTCTTGGGCTACTGCTCCGGCCTGATTGATAACCTA ATCCGGCGGAGGCCGATCGCGACGGCTGGTTTGCATCGCCAGCTTCTATATATTACGGCCTTTTTTTTT GCTGGATATTATCTTGTAAAACTTGAAGCTTATGCTAATCTGTATGTTGACACCTTGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001204054 |
Insert Size | 267 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001204054.1 |
RefSeq Size | 2284 bp |
RefSeq ORF | 267 bp |
Locus ID | 4718 |
UniProt ID | O95298 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 10.1 kDa |
Gene Summary | Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses alternate splice sites in the 3' coding region, which results in a frameshift, compared to variant 1. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231597 | NDUFC2 (Myc-DDK tagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa (NDUFC2), transcript variant 2 |
CNY 3990.00 |
|
RG231597 | NDUFC2 (tGFP-tagged) - Homo sapiens NADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2, 14.5kDa (NDUFC2), transcript variant 2 |
CNY 4370.00 |