PRPS1 (NM_001204402) Human Untagged Clone

CAT#: SC329751

PRPS1 (untagged) - Homo sapiens phosphoribosyl pyrophosphate synthetase 1 (PRPS1), transcript variant 2



  "NM_001204402" in other vectors (2)

CNY 2950.00


货期*
4周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-PRPS1/2/1L1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARTS; CMTX5; DFN2; DFNX1; PPRibP; PRS-I; PRSI
Vector pCMV6-Entry
Sequence Data
>SC329751 representing NM_001204402.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGTGCTTGTGGGAGATGTGAAGGATCGGGTGGCCATCCTTGTGGATGACATGGCTGACACTTGTGGC
ACAATCTGCCATGCAGCTGACAAACTTCTCTCAGCTGGCGCCACCAGAGTTTATGCCATCTTGACTCAT
GGAATCTTCTCCGGTCCTGCTATTTCTCGCATCAACAACGCATGCTTTGAGGCAGTAGTAGTCACCAAT
ACCATACCTCAGGAGGACAAGATGAAGCATTGCTCCAAAATACAGGTGATTGACATCTCTATGATCCTT
GCAGAAGCCATCAGGAGAACTCACAATGGAGAATCCGTTTCTTACCTATTCAGCCATGTCCCTTTATAA

Restriction Sites SgfI-MluI     
ACCN NM_001204402
Insert Size 345 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001204402.1
RefSeq Size 1748 bp
RefSeq ORF 345 bp
Locus ID 5631
UniProt ID P60891
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Pentose phosphate pathway, Purine metabolism
MW 12.3 kDa
Gene Summary This gene encodes an enzyme that catalyzes the phosphoribosylation of ribose 5-phosphate to 5-phosphoribosyl-1-pyrophosphate, which is necessary for purine metabolism and nucleotide biosynthesis. Defects in this gene are a cause of phosphoribosylpyrophosphate synthetase superactivity, Charcot-Marie-Tooth disease X-linked recessive type 5 and Arts Syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...